A variant of TP53 gene (rs 1625895, 13494g>A) is associated with neoplasm localization in patients with uterine leiomyoma

Kornatska A.G.1, Flaksemberg М.А.2, Chubei G.V.1, Trokhymovych О.V.1, Rossokha Z.I.*3, Fishchuk L.Ye.3, Medvedieva N.L.3, Vershyhora V.O.3, Gorovenko N.G.4

Summary. Background: Uterine leiomyoma (UL) is the most common benign neoplasm of the uterus. It is still unknown surely what exactly initiates transformation of the uterine myometrial cells into UL. Aim: To study the effect of the TP53 gene variants on the risk of development and clinical features of UL. Materials and Methods: Case-control study was performed using molecular genetic analyses of variants rs1042522 (119 G>C) and rs1625895 (13494G>A) of TP53 gene in patients with UL and comparison group of healthy women. Results: Investigated TP53 gene variants were not associated with the risk of UL development. The patients with the 13494GG genotype (rs1625895) had significantly more often subserous UL (р < 0.05). In patients with heterozygous variant of TP53 — 13494GA genotype (rs1625895) intramural UL was observed (р < 0.05). Conclusions: The rs1625895 (13494G>A) variant of TP53 gene was associated with UL localization. The identified dependence of the UL localization on the TP53 gene variant could be useful for personalized approach to treatment.

DOI: 10.32471/exp-oncology.2312-8852.vol-43-no-2.16195

Submitted: May 07, 2021.
*Correspondence: E-mail: zoiroh071@gmail.com
Abbreviation used: UL — uterine leiomyoma.

Uterine leiomyoma (UL) is the most common benign neoplasm of the uterus. According to various data, UL is highly prevalent in women all over the world [1]. Due to the high prevalence and concomitant symptoms that can significantly affect the quality of life (e.g., uterine bleeding, lower abdominal pain, impaired fertility), this disease is a significant problem for the health care system.

It is known that the development of UL is a complex, multi-stage and multifactorial process. Growth factors, cytokines, steroid hormones of the ovaries play a key role in its formation and development [2–4]. However, it is still unknown what exactly initiates the transformation of the uterine myometrial cells into UL. The pathophysiology and trigger mechanisms that contribute to the development of UL are not fully understood. In particular, UL origin could be associated with the mechanisms involved in cell cycle regulation and DNA repair.

Many studies focused on the associations between gene variants encoding regulatory proteins of the cell cycle and the risk of development of various tumors. Among the available data, a large number of research are devoted to the study of TP53 gene variants, which encodes the p53 protein — a multifunctional transcription factor activated in response to stress factors: DNA damage, oncogene activation, hypoxia, etc. [5–7]. It was shown that high expression of p53 is found in 13% cases [8]. To date, more than 400 confirmed variants in the TP53 gene have been identified [9]. Among them, the rs1042522 (G119C or Arg72Pro) and rs1625895 (G13494A) variants are the most significant and common. We have found few reports on a relationship between TP53 variants and the risk of UL development, which have yielded contradictory results. Therefore, the aim of our research was to investigate the effect of the TP53 gene variants on the risk of development and clinical features of UL.

MATERIALS AND METHODS

The study enrolled 63 patients with UL, the diagnosis was made in accordance with the standards of the Ministry of Public Health of Ukraine. The mean age of patients with UL was 38.4 ± 6.9 years, BMI — 25.3 ± 4.2. The duration of the disease in the examined patients with UL, who were under constant follow-up at the Department of Rehabilitation of Reproductive Function of Women at the Research Institute of Pediatrics, Obstetrics and Gynecology since 2015, ranged from 2 months to 15 years, and averaged 3.8 ± 0.6 years.

During the observation period, patients underwent a complete clinical and laboratory examination according to the WHO recommendations, which included a study of the nature of complaints, medical history, reproductive history, conducted therapy. Gynecological examinations were performed according to general schemes. The structure and topography of myomatous nodes, the features of their vascularization in patients were studied by the ultrasound examination on the MyLab Seven device with a transabdominal 4–8 Hz and a transvaginal sensor at a scanning frequency of 4–9 Hz. We used ICD 10, 1990 and FIGO, 2011 classifications.

The control group consisted of 41 apparently healthy women of the appropriate age (mean age — 38.5 ± 11.0 years, BMI — 24.6 ± 4.5), who were not diagnosed with the disease during a standard examination.

Informed consent was obtained from each participant included in the study before the collection of blood. The study was approved by the Ethics Committee of State Institution “Institute of Pediatrics, Obstetrics and Gynecology of NAMS of Ukraine”.

The genomic DNA for molecular genetic studies was isolated from peripheral blood using a commercial “Quick-DNA Miniprep Plus Kit” (Zymo Research, USA) according to the manufacturer’s protocol. The rs1042522 and rs1625895 variants of the TP53 gene were determined using the PCR-RFLP method according to the previously published protocols [10, 11]. The studied gene regions were amplified using a commercial kit “DreamTaq Green PCR Master Mix” (Thermo Scientific, USA) and specific oligonucleotide primers (Metabion, Germany). The amplification products of DNA fragments of the TP53 gene were subjected to hydrolytic cleavage using appropriate restriction endonucleases (Thermo Scientific, USA). Information on the sequence of primers and restriction endonucleases is presented in Table 1.

Table 1. Summary of PCR-RFLP analysis

Variant Primer sequence (5´ to 3´) Anneal T, °C Restriction enzyme Size of amplicon and restriction fragments (bp)
TP53rs1042522 CTGGTAAGGACAAGGGTTGG 60 BstUI Amplicon: 397119G: 166, 231119C: 397
ACTGACCGTGCAAGTCACAG
TP53rs1625895 TGGCCATCTACAAGCAGTCA 57 MspI Amplicon: 40413494G: 69, 33513494A: 404
TTGCACATCTCATGGGGTTA
Note: fragments up to 80 bp in size in agarose gel are not clearly visualized.

The digested products were separated using agarose gel electrophoresis and visualized on a UV transilluminator (Fig. 1, 2).

 A variant of <i>TP53</i> gene (rs 1625895, 13494g>A) is associated with neoplasm localization in patients with uterine leiomyoma
Fig. 1. Electrophoregram of restriction fragments for the rs1042522 variant of the TP53 gene: 1, 2, 6, 9, 10, 12, 13, 15, 18 — 199GG genotype; 3–5, 8, 11, 16, 17 — 199GC genotype; 7, 14 — 199CC genotype; M — DNA marker
 A variant of <i>TP53</i> gene (rs 1625895, 13494g>A) is associated with neoplasm localization in patients with uterine leiomyoma
Fig. 2. Electrophoregram of restriction fragments for the rs1625895 variant of the TP53 gene: 1–7, 9, 10, 11, 14–17 — 13494GG genotype; 8, 10, 12, 13 — 13494GA genotype; 18 — 13494AA genotype; M — DNA marker

Statistical data processing was conducted using the Microsoft Excel Pro Plus 2016 and SPSS v.27 software. Genotype and allele frequencies in the study and control groups were compared using the χ2 test. The studied parameters were checked for the normality of distribution by Kolmogorov — Smirnov test. In the case of a normal distribution, the significance of differences between the indicators was determined using Student’s t-test, and in a distribution that differed from the normal one, the Mann-Whitney U-test was used. Differences were considered significant for all types of analysis at p < 0.05.

RESULTS

The distribution of the TP53 gene variants in patients with UL and in the control group was analyzed (Table 2). No significant differences were found, indicating that the studied gene variants were not associated with a risk of developing the disease.

Table 2. Comparison of the TP53 gene variants distribution frequency in UL and control groups

Genevariants Genotype, allele ULgroup (n = 63) Controlgroup (n = 41)
TP53rs1042522 119GG 30 (47.6%) 24 (58.5%)
119GC 28 (44.4%) 12 (29.3%)
119CC 5 (7.9%) 5 (12.2%)
119G 0.70 0.73
119C 0.30 0.27
TP53rs1625895 13494GG 47 (74.6%) 32 (78.0%)
13494GA 15 (23.8%) 6 (14.6%)
13494AA 1 (1.6%) 3 (7.3%)
13494G 0.87 0.85
13494A 0.13 0.15
Note: p > 0.05 for all comparisons.

Another aspect of our study was to examine the possible influence of the studied variants of the TP53 gene on the course of the disease. To do this, we analyzed the clinical parameters in the group of patients with UL depending on the genotypes (Table 3).

Table 3. Comparison of genotypes with clinical characteristics of UL patients

TP53  rs1042522 TP53  rs1625895
119GG 119GC 119СС 13494GG 13494GA 13494AA
Age (y) 39.2 ± 7.8 37.8 ± 6.1 34.8 ± 0.8 38.3 ± 7.2 38.2 ± 5.8 36.0
Type of treatment
Conservative 10 (41.7%) 11 (45.8%) 3 (12.5%) 19 (79.2%) 41 (16.7%) 1 (4.2%)
Surgical 19 (52.8%) 16 (44.4%) 1 (2.8%) 27 (75.0%) 9 (25.0%) 0 (0%)
Focality of myomatosis
Unifocal 10 (50.0%) 9 (45.0%) 1 (5.0%) 16 (80.0%) 4 (20.0%) 0 (0%)
Multifocal 16 (44.4%) 17 (47.2%) 3 (8.3%) 26 (72.2%) 9 (25.0%) 1 (2.8%)
Size of the dominant node (mm) 55.1 ± 43.1 42.7 ± 26.0 29.0 ± 15.1 49.6 ± 37.7 41.9 ± 26.6 32.0
FIGO stage
0–II 0 (0%) 2 (100.0)% 0 (0%) 1 (50.0%) 1 (50.0%) 0 (0%)
III–V 15 (44.1%) 15 (44.1%) 4 (11.8) 22 (64.7%)* 11 (32.4%)* 1 (2.9%)*
VI–VII 12 (57.1%) 9 (42.9%) 0 (0%) 20 (95.2%)* 1 (4.8%)* 0 (0%)*
Pathology of endometrium
No 8 (30.8%) 16 (62.5%) 2 (7.7%) 17 (65.4%) 8 (30.8%) 1 (3.8%)
Yes 12 (60.0%) 7 (35.0%) 1 (5.0%) 17 (85.0%) 3 (15.0%) 0 (0%)
Complications of the principal diagnosis
No 13 (52.0%) 12 (48.0%) 0 (0%) 21 (84.0%) 4 (16.0%) 0 (0%)
Yes 16 (45.7%) 15 (42.9%) 4 (11.4%) 25 (71.4%) 9 (25.7%) 1 (2.9%)
Note: *The difference in distribution of TP53 rs1625895 genotypes is significant between patients with FIGO stage of UL — III–V and VI–VII, p < 0.05.

In the presence of the 119CC genotype, patients tended to develop the disease at a younger age as compared to the 119GG genotype, but the size of the dominant node was smaller. Patients with the 119GG genotype, on the other hand, developed the disease at an older age, but the size of the dominant node was larger. These features indicate that the potential multidirectional influence of the studied gene variants on the manifestation of the disease and its course is obvious.

Patients with subserous UL (FIGO stage VI–VII) significantly more frequently (χ2 = 5.12, p = 0.02) had the 13494GG genotype as compared to patients with intramural UL (FIGO stage III–V). In contrast, a significantly increased frequency of the heterozygous 13494GA genotype (χ2 = 4.29, p = 0.04) was observed in patients with the intramural localization of the disease as compared to subserous localization.

For the rest of the studied clinical characteristics listed in Table 3, no significant differences were found.

DISCUSSION

Clinical application of the up-to-date techniques in genetic analysis helps to deepen our knowledge about the development and progression of various neoplasms. In this regard, SNP analysis is a powerful approach to extensive genomic screening of candidate genes that may be involved in the development of multifactorial diseases. p53 protein is involved in the regulation of cell cycle, cell growth and apoptosis. One of the most studied variants of the TP53 gene is the G119C gene variant, which causes the proline to arginine substitution at codon 72 (CCC to CGC). As a result, two variants of p53, which have different biochemical properties, are formed. The genotypes of variant rs1042522 of TP53 gene are significantly associated with different levels of p53 expression in cells [12]. According to the literature, the 119C variant is crucial for the specific activation of p53-dependent DNA repair genes in different cells, which leads to higher efficiency of DNA repair in vitro [13]. Perhaps that is why our patients with the 119CC genotype had a smaller size of the dominant node. In contrast, p53 protein formed by 119G variant is more effective inducer of apoptosis [14] and therefore the development of the disease in the examined patients occurred later. In addition, the rs1625895 variant is a common and possible biomarker, which is localized in the 6th intron of TP53 gene and affects the function and expression of p53 [15]. The results of our research showed that this variant of the gene was associated with the localization of UL.

Analysis of the literature to study the possible impact of the rs1042522 and rs1625895 variants of the TP53 gene on the risk of developing UL demonstrated quite contradictory results. In most studies, no relationship was found between the rs1042522 variant of the TP53 gene and the risk of developing UL [16–18]. These data are completely consistent with our results. In contrast, studies by other authors have shown an association between the rs1042522 variant of TP53 and the risk of developing UL [19–21]. This discrepancy in the results can be explained by the population difference in the frequencies of the rs1042522 variant of the TR53 gene, or by the influence of other genetic or environmental factors. We did not find any data on the study of the role of the rs1625895 variant of the TP53 gene in the development of UL, therefore, the detected features as to the distribution of this variant of the gene with different frequency at different localization of the tumor process are important for further clinical consideration.

To sum up, our study did not find an association of the rs1042522 and rs1625895 variants of the TP53 gene with the risk of developing UL. The rs1625895 variant of the TP53 gene was associated with UL localization. If patients had the 13494GG genotype, subserous UL was detected significantly more often, and in the heterozygous variant of the 13494GA genotype, intramural UL was observed. The identified association of UL localization on the TP53 gene variant is an important prerequisite for a personalized approach to treatment.

REFERENCES

  • 1. Tokarz J, Adamski J, Rižner TL. Metabolomics for diagnosis and prognosis of uterine diseases? A systematic review. J Pers Med 2020; 10: 294.
  • 2. Ciarmela P, Islam MS, Reis FM, et al. Growth factors and myometrium: biological effects in uterine fibroid and possible clinical implications. Hum Reprod Update 2011; 17: 772–90.
  • 3. Moravek MB, Yin P, Coon JS 5th, et al. Paracrine pathways in uterine leiomyoma stem cells involve insulinlike growth factor 2 and insulin receptor a. J Clin Endocrinol Metab 2017; 102: 1588–95.
  • 4. Reis FM, Bloise E, Ortiga-Carvalho TM. Hormones and pathogenesis of uterine fibroids. Best Pract Res Clin Obstet Gynaecol 2016; 34: 13–24.
  • 5. De Souza C, Madden J, Koestler DC, et al. Effect of the p53 P72R polymorphism on mutant TP53 allele selection in human cancer. J Natl Cancer Inst 2021: djab019.
  • 6. De Souza C, Madden JA, Minn D, et al. The P72R polymorphism in R248Q/W p53 mutants modifies the mutant effect on epithelial to mesenchymal transition phenotype and cell invasion via CXCL1 expression. Int J Mol Sci 2020; 21: 8025.
  • 7. Diakite B, Kassogue Y, Dolo G, et al. p.Arg72Pro polymorphism of P53 and breast cancer risk: a meta-analysis of case-control studies. BMC Med Genet 2020; 21: 206.
  • 8. Liang Y, Zhang X, Chen X, et al. Diagnostic value of progesterone receptor, p16, p53 and pHH3 expression in uterine atypical leiomyoma. Int J Clin Exp Pathol 2015; 8: 7196–202.
  • 9. IARC TP53 Database. Release R20, 2019. Available from https://www-p53.iarc.fr/.
  • 10. Lajin B, Alachkar A, Alhaj SA. Duplex detection of TP53 Arg72Pro and 16 bp del/ins polymorphisms by a simple optimized PCR-RFLP method. N Am J Med Sci 2012; 4: 212–5.
  • 11. Hu Z, Li C, Chen K, et al. Single nucleotide polymorphisms in selected apoptotic genes and BPDE-induced apoptotic capacity in apparently normal primary lymphocytes: a genotype-phenotype correlation analysis. J Cancer Epidemiol 2008; 2008: 147905.
  • 12. Zhang G, Xu Q, Wang Z, et al. p53 protein expression affected by TP53 polymorphism is associated with the biological behavior and prognosis of low rectal cancer. Oncol Lett 2019; 18: 6807–21.
  • 13. Proestling K, Hebar A, Pruckner N, et al. The Pro allele of the p53 codon 72 polymorphism is associated with decreased intratumoral expression of BAX and p21, and increased breast cancer risk. PLoS One 2012; 7: e47325.
  • 14. Shen CC, Cheng WY, Lee CH, et al. Both p53 codon 72 Arg/Arg and pro/Arg genotypes in glioblastoma multiforme are associated with a better prognosis in bevacizumab treatment. BMC Cancer 2020; 20: 709.
  • 15. Sharma S, Sambyal V, Guleria K, et al. TP53 polymorphisms in sporadic North Indian breast cancer patients. Asian Pac J Cancer Prev 2014; 15: 6871–9.
  • 16. Hsieh YY, Chang CC, Tsai FJ, et al. Tumor necrosis factor-alpha-308 promoter and p53 codon 72 gene polymorphisms in women with leiomyomas. Fertil Steril 2004; 82: 1177–81.
  • 17. Ziaei E, Chaleshtori MH, Ziaei A, et al. Polymorphisms of p53 promoter and susceptibility to uterine leiomyoma. Clin Exp Obstet Gynecol 2016; 43: 713–7.
  • 18. Patrikis MI, Bryan EJ, Thomas NA, et al. Mutation analysis of CDP, TP53, and KRAS in uterine leiomyomas. Mol Carcinog 2003; 37: 61–4.
  • 19. Denschlag D, Bettendorf H, Watermann D, et al. Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma. Fertil Steril 2005; 84: 162–6.
  • 20. Yaghmaei M, Salimi S, Namazi L, et al. Association of XRCC1 Arg399GIn and Tp53 Arg72Pro polymorphisms and increased risk of uterine leiomyoma — A case-control study. Genet Mol Biol 2015; 38: 444–9.
  • 21. Altinkaya SO, Avcioglu SN, Sezer SD, et al. Analysis of TP53 gene in uterine myomas: No mutations but P72R polymorphism is associated with myoma development. J Obstet Gynaecol Res 2019; 45: 2088–94.

ВАРІАНТ ГЕНА TP53 (rs 1625895, 13494G>A) ПОВ’ЯЗАНИЙ ІЗ ЛОКАЛІЗАЦІЄЮ НОВОУТВОРЕННЯ У ХВОРИХ НА ЛЕЙОМІОМУ МАТКИ

А.Г. Корнацька1, М.А. Флаксемберг2, Г.В. Чубей1, О.В. Трохимович1, З.І. Россоха3, Л.Є. Фіщук3, Н.Л. Медведєва3, В.О. Вершигора3, Н.Г. Горовенко4

1Державна установа «Інститут педіатрії, акушерства і гінекології імені академіка О.М. Лук’янової НАМН України», Київ, 04050, Україна
2Хмельницький перинатальний центр, Хмельницький, 29016, Україна
3Державний заклад «Референс-центр з молекулярної діагностики Міністерства охорони здоров’я України», Київ, 04112, Україна
4Національний університет охорони здоров’я України імені П.Л. Шупика, Київ, 04112, Україна

Резюме. Стан питання: Лейоміома матки (ЛМ) є найпоширенішим доброякісним новоутворенням матки. Досі достеменно невідомо, що саме ініціює перетворення клітин міометрія матки на ЛМ. Мета: Дослідити вплив варіантів гена TP53 на ризик розвитку та клінічні особливості ЛМ. Матеріали та методи: Дослідження «випадок-контроль» проводили з використанням молекулярно-генетичного аналізу варіантів rs1042522 (119G>C) та rs1625895 (13494G>A) гена TP53 у пацієнток з ЛМ та у жінок групи порівняння. Результати: Досліджені варіанти гена TP53 не були асоційовані з ризиком розвитку ЛМ. У пацієнток з генотипом 13494GG (rs1625895) значно частіше відмічали субсерозну ЛМ (р < 0.05). А у пацієнток з гетерозиготним варіантом гена TP53 генотип 13494GA (rs1625895) частіше виявляли інтрамуральну ЛМ (р < 0.05). Висновки: Варіант rs1625895 (13494G>A) гена TP53 був асоційованим з локалізацією новоутворення. Виявлена ​​залежність локалізації ЛМ від варіанту гена TP53 є важливою передумовою персоналізованого підходу до лікування.

Ключові слова: лейоміома матки, ризик розвитку, варіанти гена TP53, локалізація новоутворення.

No Comments » Add comments
Leave a comment

ERROR: si-captcha.php plugin says GD image support not detected in PHP!

Contact your web host and ask them why GD image support is not enabled for PHP.

ERROR: si-captcha.php plugin says imagepng function not detected in PHP!

Contact your web host and ask them why imagepng function is not enabled for PHP.