![]() |
![]() |
![]() |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2021-06-29 :
Significance of BRAFV600E mutation in intra-axial brain tumor in Malaysian patients: case series and literature reviewMohamed Yusoff A.A.*, Abd Radzak S.M., Mohd Khair S.Z.N., Abdullah J.M. Summary. Background: To date, BRAF mutations in brain tumor patients have not been characterized in the Malaysian population. Based on the numerous reported studies, there are main mutations that exist in BRAF gene in various types of cancers. A missense mutation in codon 600 of the BRAF nuclear oncogene (BRAFV600E) is the most prevalent hotspot point mutation that has been identified in multiple human malignancies. Aim: We here aimed to find out the frequency of BRAFV600E mutation in a series of Malaysian patients with brain tumors and if any association exists between BRAFV600E mutation and clinicopathological features of patients. Material and Methods: Fresh frozen tumor tissue samples from 50 Malaysian brain tumor patients were analyzed for BRAFV600E mutational status, and its correlation with clinicopathological features (including age, gender, and tumor localization such as intra-axial: within the brain substance or extra-axial: outside the brain substance) was examined. Results: The overall BRAFV600E mutation frequency was determined to be 22% (in 11 of 50 patients). BRAFV600E was significantly correlated with the tumor location group, which shows BRAFV600E was more frequent in the intra-axial tumor than the extra-axial tumor group. In this study, we also observed that male patients were slightly more susceptible to BRAFV600E mutation, and this mutation was predominant in patients of the age group < 40 years. However, these parameters did not translate to statistical significance. Conclusion: The data demonstrate that BRAFV600E mutation is observed significantly more often in intra-axial brain tumor patients, which can serve as baseline information for further research on genetic alteration that occurs during brain tumor progression in the Malaysian population. Submitted: June 29, 2020.
*Correspondence: E-mail: azizmdy@yahoo.com Abbreviations used: A II — astrocytoma WHO grade II; AA III — anaplastic astrocytoma WHO grade III; CNS — central nervous system; GG — ganglioglioma; PA — pilocytic astrocytoma WHO grade I; PCR — polymerase chain reaction; PXA III — anaplastic pleomorphic xanthoastrocytoma WHO grade III; RFLP — restriction fragment length polymorphism. DOI: 10.32471/exp-oncology.2312-8852.vol-43-no-2.16076 The primary brain and other intracranial central nervous system (CNS) tumors are a heterogeneous group of neoplasms. The epidemiology review report of brain cancer in the world determined that the incidence of CNS cancer is increasing [1, 2]. Its incidence and mortality rate has been reported to be 3.4 and 2.5 per 100,000 people in the world [2]. In Malaysia, the incidence trends of CNS tumors also have been increasing by years, and it is estimated to be 9.8% in 2020 [3]. Despite the great progress that has been performed in understanding biology of these tumors and modern advances in treatments comprising in neurosurgical and radiotherapy techniques management, the 5-year survival rate for primary malignant CNS tumors is one of the worst among all human cancers. Primary brain tumors comprise many diverse tumor types originating from the brain parenchyma or meninges, which fall under the WHO classification scheme of tumors [4]. They can be divided into two subcategories based on whether the site of the origin (the localization of the tumor developed) is intra-axial (intraparenchymal) or extra-axial (outside the brain substance). Intra-axial tumors are defined as the lesions that develop within the brain parenchyma. The most common intra-axial tumor types are gliomas. Extra-axial tumors are lesions, which originate outside the brain substance commonly arise from the skull, meninges, or tissues other than the brain parenchyma. The most prevalent extra-axial tumor types are meningiomas, craniopharyngiomas, and schwannomas. The progression of brain tumors has been implicated with multiple oncogenic events, involving several genetic and epigenetic defects in signaling pathways with a diversity of altered genes. The v-RAF murine sarcoma viral oncogene homolog B1 (BRAF) gene is involved in brain tumorigenesis since a few researchers for the first time have discovered the mutations of the BRAF gene in CNS tumors [5–7]. The human BRAF gene is located on 7q34, and its mRNA spans 2478-bp. It is 190-Kbp long consisting of 18 exons, which encodes the cytosolic 766 amino acids of serine-threonine protein kinase of the RAF family. The BRAF protein plays roles in modulating the RAS/RAF/MEK (mitogen-activated protein kinase)/ERK (extracellular signal-regulated kinase) signaling pathway (also known as the MAPK/ERK kinase pathway), which is responsible for a wide range of cellular functions, including cellular proliferation, survival, differentiation, migration, angiogenesis, and apoptosis [8]. Modulation of MAPK/ERK kinase pathway is crucial for the stability between extracellular signaling and gene transcription. Thus, mutations in BRAF trigger inappropriate activation of this pathway that ultimately can result in uncontrolled cell proliferation and tumorigenesis [8]. Following the pioneering work by the Davies’s team regarding BRAF mutations in human cancer [5], a substantial number of studies have discovered BRAF mutations in a variety of human solid cancer including melanomas [9–12], papillary thyroid carcinomas [13–16], colorectal cancers [17–19], prostate cancers [20–22], ovarian cancers [23–25], and brain tumors [6, 7, 26]. As stated in the database by Catalogue of Somatic Mutations in Cancer, BRAF mutations are harbored mostly in about 55% of papillary thyroid carcinomas, 45% of the melanomas, 13% of colorectal cancers and 8% of brain tumors (www.sanger.ac.uk/genetics/CGP/cosmic). The majority of studies noted that most BRAF mutations occurred within the kinase activation domain region that is restricted to exon 11 or 15. A missense mutation in exon 15 at nucleotide position 1799 of the BRAF gene accounts for over 90% of the mutations identified in cancer studies [27]. This point mutation (T to A transversion) turns the amino acid substitution at codon 600 from valine into glutamic acid (referred to as BRAFV600E: nucleotide 1799 T > A; codon GTG > GAG). This mutation leads to an alteration in the conformation of the active kinase site that results in the high-level constitutive activation of the ERK pathway, contributing to tumorigenesis [28]. In addition to BRAFV600E mutation, another predominant defect in the BRAF gene is a chromosomal rearrangement, which is involved in a tandem duplication of 7q34 that transformed into a fusion between the previously undefined gene KIAA1549 and the BRAF genes [29]. This novel KIAA1549-BRAF oncogenic fusion seems to be present in most low-grade glioma, particularly, the majority of pilocytic astrocytomas (PA) [29, 30] and predicts the best clinical outcome among pediatric low-grade astrocytomas [31]. The role of BRAFV600E mutation as a potential therapeutic target and biomarker of the progression of brain tumors has attracted the attention of the researchers in cancer field. Nevertheless, the data on this mutation in the Asian population, specifically from Southeast Asians are insufficient. To the best of our knowledge, no data are reporting the frequency of BRAFV600E mutation in the Malaysian population with brain tumors. In the present study, we aimed to evaluate the frequency of BRAFV600E mutation in a series of Malaysian patients with brain tumors and to assess the association between this mutation and clinic-pathological characteristics. MATERIALS AND METHODSCase series. The investigation was performed using freshly frozen brain tumor specimens obtained from 50 Malaysian patients who underwent the neurosurgical operation at the Department of Neurosciences, Universiti Sains Malaysia, Health Campus, in 2016–2019. Patients who received radiotherapy and chemotherapy were excluded from this study. A least two consultant neuropathologists confirmed the histopathological diagnosis and grading of tumor tissue samples according to the WHO classification of brain tumors. This study was conducted in line with the Declaration of Helsinki, with all patients provided written informed consent and was approved by the Research Ethics Committee of Universiti Sains Malaysia (IRB Reg. № 00004494). The control group represented normal human brain tissues collected from 20 archival paraffin-embedded autopsy tissues of motor vehicle fatal accident victims. A summary of patients’ and tumor characteristics is presented in Table 1. Table 1. Demographic and clinic-pathological characteristics of patients
Genomic DNA extraction and quantification. Total genomic DNA was extracted from tumor tissues as per the manufacturer’s instructions using the QIAamp DNA mini kit (QIAGEN, Hilden, Germany). The genomic DNA concentration was quantified using NanoDrop ND1000 spectrophotometry (Thermo Scientific, Waltham, MA, USA). All qualified DNAs were stored at –80 °C until analysis. Polymerase chain reaction (PCR) amplification of BRAF codon V600E. A fragment in exon 15 of the BRAF gene spanning codon 600, was PCR-amplified using the specific primer pair. PCR primer sequences were as follows: Forward primer: GCTTGCTCTGATAGGAAAATGAG; Reverse primer: GTAACTCAGCAGCATCTCAGG. The expected amplicon length is 237 bp. The reaction mixture (20 μL) of the PCR contained: 100 ng of total DNA, 1.5 mM HF buffer, 0.5 µM of each primer, 200 µM of dNTPs, and 0.02 U/µl of Phusion high-fidelity DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR cycles were performed using the following conditions: 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and final elongation for 2 min. Restriction fragment length polymorphism (RFLP) analysis. Hotspot codon V600E mutation of the BRAF gene was analyzed by RFLP. TspRI restriction endonuclease (New England Biolabs, Ipswich, MA, USA) digestion was performed for all 237-bp BRAF PCR products based on the manufacturer’s instructions. Digestions were carried out in a total volume of 15 μL. The reaction mixture consisted of 3 μL of PCR product, 1 μL of restriction buffer (10X), 0.5 μL of restriction enzyme (10 U/μL) and the volume was adjusted with sterile distilled water. Then the digestion reaction was incubated for 20 min at 65 °C. The restriction fragments were analyzed on 4% MetaPhorTM agarose gel in TBE buffer, stained with SYBR safe, and visualized under ultraviolet light. Wild-type BRAF showed in three bands of 117 bp, 87 bp, and 33 bp, whereas BRAFV600E mutation resulted in four bands of 204 bp, 117 bp, 87 bp, and 33 bp. Sanger DNA sequencing. Samples that displayed the mutation pattern in the RFLP assay were finally validated by Sanger DNA sequencing. PCR products for suspected samples were purified using a QIAquick PCR purification kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocols and sequenced by the same primers as that described in the PCR amplification steps. Sequencing was carried out using a Big Dye Terminator cycle sequencing kit (Applied Biosystems Inc., USA) on an ABI Prism 3700 DNA Analyzer automated sequencer (Applied Biosystems Inc., USA). Statistical analysis. Statistical analysis was performed using GraphPad Prism software version 8.4.1 (Graphpad Software Inc., San Diego, CA, USA). The association between BRAFV600E status and clinic-pathological features was analyzed using Fisher’s exact tests. The difference was considered statistically significant when the p-value was smaller than 0.05. RESULTSDetection of BRAFV600E in brain tumors. A fragment of the BRAF gene, spanning the nucleotide 1799T>A mutation hotspot at codon 600, was amplified by PCR using the specific primers. A PCR amplicon of the expected size, 237 bp was observed in agarose gel electrophoresis (Fig. 1). ![]() Fig. 1. Agarose gel electrophoresis of BRAF PCR products. Amplification products of the desired size of 237-bp were observed in 2% agarose gel. Lane M, 100-bp DNA marker; Lanes 1–6, tumor samples; Lane 7, negative control
The RFLP assay was applied to use the TspRI digestion for the BRAF PCR amplicons encompassing 1799T>A in different fragments. In the RFLP fragment patterns, wild type yielded there fragments 117 bp, 87 bp, and 33 bp, while, the heterozygote BRAFV600E mutant yielded four fragments of 204 bp, 117 bp, 87 bp, and 33 bp (Fig. 2). ![]() Fig. 2. PCR-RFLP assay of BRAFV600E obtained by 4% MetaPhorTM agarose gel electrophoresis. Lane M, 50-bp DNA ladder; Lane 1, undigested product (237-bp); Lanes 2, normal control; Lane 3–6, tumor samples. Three bands at 117 bp, 87 bp, and 33 bp indicate a wild-type. Four bands at 204 bp, 117 bp, 87 bp, and 33 bp indicate a heterozygous mutation
In the case of BRAFV600E detection in the RFLP assay, it was further validated by DNA sequencing. A comparison of results obtained using RFLP assay and DNA sequencing showed a consistent finding (Fig. 3). This BRAF mutation T to A transversion at nucleotide position 1799, converts the amino acid change from valine codon (GTG) into a glutamic acid codon (GAG) at amino acid position 600 (V600E) (see Fig. 3). ![]() Fig. 3. Representative Sanger sequencing chromatogram demonstrating validation of BRAFV600E that shows a heterozygous mutation of T to A transversion at nucleotide position 1799 (codon 600)
Frequency of BRAFV600E mutation and its clinico-pathological association. Overall, 11 cases (22%) with BRAFV600E mutation were identified by PCR-RFLP and then confirmed by Sanger sequencing. The BRAFV600E mutation was detected in 2 (40%) of 5 As II, 1 (50%) of 2 AAs III, 2 (66.7%) of 3 PXAs III, 3 (37.5%) of 8 GBMs, 2 (9.5%) of 21 meningiomas and 1 (20%) of 5 craniopharyngiomas. No BRAFV600E mutation was found in any cases of PA or schwannoma. The clinicopathological features of the patients with and without BRAFV600E mutation are summarized in Table 2. We examined the relation between BRAFV600E mutation status and various clinico-pathological features, including age at diagnosis, types of tumor, and gender. Regarding the tumor types, we distributed the patients into two groups based on the tumor localization — intra-axial and extra-axial. Table 2. Association between BRAFV600E status with clinicopathological parameters
Note: *p < 0.05.
In this study, we found that BRAFV600E mutation was significantly associated with intra-axial tumor patients (p = 0.0419). We revealed that BRAFV600E mutation was more common in the intra-axial tumor (36.4%) than the extra-axial tumor group (10.7%) DISCUSSIONBRAF activating mutation (BRAFV600E) with the substitution of valine to glutamic acid at amino acid 600, is a well-established molecular biomarker worldwide and has been identified in various cancers with variable frequency. After the initial discovery of BRAFV600E mutation in brain tumors (glioma cell lines) [5], many attempts were carried out to define the possible role of this mutation and to associate it with clinico-pathological characteristics/features of brain tumor cases. In one of the earliest studies, this hotspot mutation was identified in two cases of glioblastoma as well as in one gliosarcoma case [6]. Basto et al. [7] reported 6% of BRAFV600E mutation in 34 glioblastomas. Since then, various groups of scientists have started research with more comprehensive mutational analysis to detect BRAF gene mutations in brain tumors. There are only few studies having been performed with large numbers of primary brain tumor patients in determining the prevalence of BRAFV600E mutation. So far, two large case series of primary brain tumors have been conducted, mainly by Schindler et al. [32] who screened 1,320 CNS tumors and revealed 7% (96/1320) cases of mutation, and in the study of Behling et al. [33] on 969 analyzed tumor cases, only 1% (7/784) of the tumors had a BRAFV600E mutation. The BRAFV600E mutation has been reported in different types of adult and pediatric primary brain tumors with diverse rates, including PA (< 18% cases) [32, 34–44], pleomorphic xanthoastrocytomas (PXA; 25–78% cases) [32, 35, 37, 38, 41–52], gangliogliomas (GG; 18–88% cases) [32, 35, 37, 38, 40–43, 45, 53–61], astrocytomas WHO grade II (A II; 3–44% cases) [33, 34, 43, 56, 57, 62–64], anaplastic astrocytomas WHO grade III (AA III; 3–33% cases) [32, 37, 62, 64, 65], glioblastoma WHO grade IV (GBM; 2–38%) [6, 7, 32, 37, 42, 46, 57, 62, 64–68], epithelioid glioblastoma (E-GBM; 17–93% cases) [33, 51, 68–73], desmoplastic infantile astrocytoma/ganglioglioma (DIA/DIG; 6–75%) [45, 54, 74–76], dysembryoplastic neuroepithelial tumor (DNET; 5–97%) [38, 42, 48, 54, 56, 60], craniopharyngiomas (CP; 15–94% cases) [77–80], and only a small number reported cases in astroblastoma [81] and meningiomas [33, 82]. The BRAFV600E mutation also has been characterized by Chatterjee et al. [83] as a common event in the non-infantile variant of DIA/DIG. Published previous reports of BRAFV600E mutation in primary brain tumor types are summarized in Supplementary Table S1 online. In our study, 22% (11 out of 50 patients) of the patients were found to harbor a BRAFV600E mutation. Our research is one of the first efforts to study the frequency of BRAFV600E mutation in Malaysian patients and subsequently to correlate it with clinicopathological parameters of brain tumor cases. There is a lack of data from Malaysia regarding BRAF mutation status, and when literature searches were performed via Pubmed, Google Scholar, and other relevant resources/databases, no information or published data exist concerning BRAFV600E mutation in brain tumors in Malaysia to date. For the past few years, scientists from Asian countries have paid intensive attention to the BRAFV600E mutation in different kinds of primary brain tumors. A study performed in China revealed that 67.9% of PXA cases had the BRAFV600E mutation [52], while another research in India reported a 30% mutation frequency in GG (I) [59]. In a distinct study also conducted in China stated the rate of BRAFV600E mutation was as high as 44.4% in brainstem GG (II) [58]. The frequency of BRAFV600E mutation observed in our series is close to the one reported by Mung et al. [37] in a series of 223 CNS tumors from a Korean population, determining the frequency at 16.1% of BRAFV600E mutation. The low frequency of BRAFV600E mutation in brain tumor cases has also been identified in Asian countries, including Japan (5.1%) and China (5.9%) patients, in two previous studies by Hatae et al. [42] and Chan et al. [64], respectively. Indeed, the role of BRAF gene has been intensively studied predominantly in the western countries in order to clarify the adverse effect of BRAF mutations in the western population, in particularly in the USA. Schiffman et al. [62] studied the BRAFV600E mutation in 41 pediatric gliomas and identified 17.1% (7/41) of mutation in overall cases. Moreover, other studies from the United States by Behling et al. [33] and Ballester et al. [57] reported the lower frequency of BRAFV600E mutation in primary brain tumors with a rate of 1% (7/784) and 3.2% (12/381), respectively. The other studies, outside Asian, such as Canada, Portugal, and Germany, revealed a frequency of BRAFV600E mutation in pediatric LLG at 17% [43], pediatric gliomas at 16% [44], and CNS tumors at 7% [32], respectively. Some reports showed a negative finding of BRAFV600E mutation in brain tumor patients. Previous studies carried out by groups among a Greece population [84] and an Indian population [85] failed to show the BRAFV600E mutation in all brain tumor samples studied. Some of the possibilities for the observed discrepancies between these various studies included etiological factors, as well as the various demographic features of the patient populations in different parts of the world, which could have influenced the genetic predisposition and consequently affected the variation of BRAFV600E mutation rates. In the present study, we found a high BRAFV600E mutation frequency in APXA (66.7%) and AA III (50%), an average frequency ranges from 20% to 40% in CP, GBM, and A II, and a low frequency in meningiomas (9.5%). Our results were remarkably consistent across the studies described by Dias-Santagata et al. [46], Schindler et al. [32], Myung et al. [37], Chappé et al. [38], Ida et al. [47], Lohkamp et al. [50], Hatae et al. [42], Lassaletta et al. [43] and Ma et al. [52], where BRAFV600E mutation was predominantly observed in PXA and APXA with a high-frequency range from 60% to 83%. In the present study, the BRAFV600E mutation was found in 40% of A II cases which is in line with the previously published report of Lassaletta et al. [43]. Meanwhile, the BRAFV600E mutation seems to occur far less frequently in GBM. However, it has been reported fairly common in GBM with the epithelioid variant [51, 72, 73]. Our findings were similar to those of Tosuner et al. [68], who also discovered the mutation frequency in 37.5% of GBMs. We observed a lower mutation rate of BRAFV600E in meningiomas, where only 2 cases were detected. BRAF mutations are believed to be extremely rare in meningiomas, and only a limited number of studies have been carried out so far. Schindler et al. [32] previously reported no existence of BRAFV600E mutation in 71 analyzed meningiomas. Moreover, Behling et al. [33] yielded a lower rate of BRAFV600E mutation with 0.85% in all meningiomas grade I to III. This is in agreement with the work of Pepe et al. [82], who found less frequent BRAF mutations (8.7%) in grade I meningiomas. We also found the BRAFV600E mutation in 20% (1/5) of CP cases. Past researches suggested that 15–94% of patients with CP tumors harbor BRAFV600E mutations with the most common in the papillary variant [77–80]. In the present study, no BRAFV600E mutation was found in all 4 cases of PA. Similarly, Schiffman et al. [62] were also unable to uncover any PAs to be mutated with BRAFV600E. In another study, Faulkner et al. [30] performed immunohistochemistry assay to detect BRAFV600E mutation in 32 PA patients and found no mutation in the cohort. Formerly, the BRAFV600E mutation rate has been described in a low percentage in PA [26]. Among those studies of BRAFV600E mutation in PA, Myung et al. [37] and Bannykh et al. [39] had published the highest rate of BRAFV600E mutation in PA with 15.6% and 17.6%, respectively. Apart from PA, as consistent with the previous findings from Schindler et al. [32] and Behling et al. [33], we also did not identify any BRAFV600E mutation in our schwannoma cases. We believed that BRAFV600E mutation could be an extremely rare event that occurred in these kinds of tumors. However, in contrast to these findings, Serrano et al. [86] revealed that 3 out of 16 (18.7%) sporadic schwannoma patients had a BRAFV600E mutation. In the present study, we further divided our brain tumor patients into two subcategories according to the location of tumor, namely, brain parenchyma or meninges. We observed a significant association between BRAFV600E mutation and the localization of the tumor category which means that BRAFV600E mutation was discovered more often in intra-axial tumors compared to extra-axial tumors (p = 0.0419). There have not been many reports on the association of BRAF alterations with tumor location of brain tumors. In 2015, Faulkner et al. [30] revealed that according to tumor location, patients with PA in the midline outside of the cerebellum were significantly more likely to harbor a KIAA1549-BRAF 15-9 fusion. The BRAFV600E mutation is believed to be present in a significant subset of cases of primary brain tumors [87]. It prognostic relevance seems to depend on the histological type, age of diagnosis, and localization of tumor. A study by Tabouret et al. [49] determined that PXA with mutated BRAFV600E conferred a favorable outcome, while in two separate studies by Dahiya et al. [53] and Ho et al. [88] reported that the presence of BRAFV600E mutations was considered indicators of a poor prognostic factor among GG and diencephalic pediatric low-grade glioma patients, respectively. Our finding was in contrast to a previous study in which histologic grade of brain tumors was not correlated with the BRAFV600E mutation [37]. Furthermore, in accordance with previous studies by Myung et al. [37] and Frazão et al. [44], the present study showed no statistically significant association between BRAFV600E mutation with respect to patients’ age and gender. We determined that BRAFV600E mutation frequency in the age group < 40 years was insignificantly higher compared with the age group > 40 (p = 0.7344). BRAFV600E mutation frequency in females was slightly lower than in male patients, although not statistically significant (p = 1.000). However, some studies have reported a significant correlation between age or/and gender with BRAFV600E mutation. Behling et al. [33] found that patients with BRAFV600E mutated astrocytic tumors were significantly younger (mean age 15.3 years) compared to wild-type cases (58.2 years). In a study of glioneuronal tumors, Zhang et al. [60] detected that the BRAFV600E mutation in females (58%) was significantly higher than that in male patients (17.4%). In another study, Chen et al. [58] reported that the BRAFV600E mutation was significantly more frequently observed in female patients with diffuse gliomas of the mean age of 33.5 years. The reasons for these diversities are unclear. However, these discrepancies might be explained by the difference in sample sizes and genetic admixture of the population studied. Besides that, another explanation is due to the different research methods/assays used to detect BRAFV600E mutation. A variety of research methodologies is available for mutation detection, and in the present study, PCR-RFLP assay was performed, followed by Sanger sequencing for the verification of a BRAFV600E mutation. We observed that PCR-RFLP assay is a simple, rapid, and inexpensive screening tool for a point mutation in brain tumor patients, and it is possible to detect our patients harboring a hot spot BRAFV600E mutation. We also determined that Sanger sequencing confirmed all of the positive and negative of the PCR-RFLP results. Our study is in agreement with the previously reported use of these combination techniques for the detection of BRAFV600E mutation associated with cancer cases [9, 13, 17]. Identification of BRAFV600E mutation in a considerable rate of our patients indicates that this gene may play a role in the incidence of brain tumors in the Malaysian population. Further research with larger sample sizes, and perhaps with additionally analyzing the entire BRAF coding regions in all the patients, is truly needed to understand the mechanisms involved in the mutation of the BRAF gene in the brain tumorigenesis, particularly in the Malaysian population. Interestingly, some studies have demonstrated that the presence of BRAFV600E alone is not enough to trigger gliomagenesis. Combination with other genetic alterations (such as ATRX inactivation, CDKN2A/B homozygous deletion, and TERT promoter mutation) may necessarily be required in promoting tumor development [73, 89, 90]. For the future, additional molecular and genetic markers analysis is worth investigating. The advancement in the study of the mutation might be the starting point for future possible BRAFV600E targeted therapy, which stated by Smith-Cohn et al. [91] to be beneficial for a variety of cancers such as melanoma and anaplastic thyroid cancer. In the meantime, high-level evidence for targeted therapy efficacy in primary brain tumors is still limited, as such minimal clinical benefit was observed for targeting BRAFV600E in anaplastic PXA and glioblastoma patients from the United States. The specific genetic diagnosis of brain tumors for BRAF mutations or fusions is essential in the context of emerging targeted therapies [92, 93]. The BRAF mutation-specific small molecule inhibitors have been effectively tested in metastasized melanoma. Patients harboring BRAFV600E-mutated malignant melanoma metastases have displayed significant improvement in overall survival after treating with BRAF specific inhibitors [92, 94]. These inhibitors can also be considered to treat different cancer types, particularly CNS tumors with BRAF alterations. However, some research indicates that the treatment appears to be less effective in the CNS due to the existence of physical obstacles imposed by the blood-brain barrier that prevents sufficient drug delivery to the brain [92]. So far, responsiveness to BRAF (vemurafenib, dabrafenib)/MEK inhibitors has been observed in CNS tumor patients in some studies and clinical trials [65, 95, 96]. In 2018, Kaley et al. [96] conducted the VE-BASKET study, a non-randomized open-label multicohort study for BRAFV600E-mutant glioma patients. They found that several BRAFV600E mutant tumor cases, mainly in PXA, exhibited the best response to vemurafenib treatment. Several ongoing early-stage clinical trials are now focused on targeted-treatment for the recurrent BRAFV600E-mutant gliomas in children and young adults and pediatric primary low-grade gliomas using vemurafenib (NCT0174189) and dabrafenib with trametinib (NCT01748149) [92, 93]. A phase II clinical trial is now also underways for recruiting adult craniopharyngioma patients with BRAF-mutated tumors for vemurafenib and cobimetinib treatment (NCT03224767) [92, 93]. Up to now, there is uncertainty regarding the relative effectiveness of BRAFV600E mutation-specific antibodies in the CNS. Thus, several attempts have been made for the evaluation of ERK signaling pathway activity in recurrent tumor tissue and cerebrospinal fluid following dabrafenib and/or trametinib treatment [92]. To sum up, this study is the first to be conducted in Malaysia regarding BRAFV600E mutation in primary brain tumors in the Malaysian population. Despite that, the number of patients in the present study was small, the data show a considerable BRAFV600E mutation rate in primary brain tumor patients, most significantly observed in the intra-axial tumors group. This study will provide information about the frequency or prevalence of BRAF gene mutations, which specifically will serve as baseline data for further research on the possible involvement of BRAFV600E mutation in the brain tumorigenesis events in the Malaysian population. CONFLICT OF INTERESTThe authors declare that they have no conflicts of interest. AcknowledgmentThis study was funded by the Research University Grant (RUI) from University Sains Malaysia (Research University Grant: 1001/PPSP/8012242 & 1001/PPSP/8012218). References
ЗНАЧЕННЯ МУТАЦІЇ BRAFV600E ПРИ ІНТРААКСІАЛЬНИХ ПУХЛИНАХ МОЗКУ У ПАЦІЄНТІВ МАЛАЙЗІЇ: СЕРІЯ ВИПАДКІВ І ОГЛЯД ЛІТЕРАТУРИВідділення неврології, Школа медичних наук, Університет Сайнс Малайзія, Медичний кампус, Кубанго Керіан 16150, Келантан, Малайзія Резюме. Стан питання: До сьогодні мутації у гені BRAF у пацієнтів з пухлинами головного мозку не були охарактеризовані серед населення Малайзії. У численних дослідженнях повідомляється про існування основних мутацій у гені BRAF при різних типах раку. Міссенс-мутація в кодоні 600 ядерного онкогена BRAF (BRAFV600E) є найбільш поширеною мутацією в «гарячій точці», яка була ідентифікована у численних злоякісних новоутвореннях людини. Мета: з’ясувати частоту мутації BRAFV600E у серії малазійських пацієнтів з пухлинами головного мозку і встановити, чи існує зв’язок між мутацією BRAFV600E і клініко-патологічними особливостями пацієнтів. Матеріал та методи: Мутаційний статус BRAFV600E було проаналізовано у свіжозаморожених зразках пухлинної тканини, отриманих від 50 малазійських пацієнтів з пухлинами головного мозку, та визначено його кореляцію з клініко-патологічними особливостями пацієнтів (включаючи вік, стать і локалізацію пухлини, наприклад, інтрааксіальна — всередині речовини мозку, або позааксіальна: поза речовиною мозку). Результати: Загальна частота мутації BRAFV600E склала 22% (11 з 50 пацієнтів). Наявність мутації BRAFV600E достовірно корелювала з локалізацією пухлини, зокрема показано, що BRAFV600E частіше зустрічалась у групі інтрааксіальних пухлин, ніж у групі екстрааксіальних пухлин. У цьому дослідженні ми також виявили, що пацієнти чоловічої статі були дещо більш сприйнятливі до мутації BRAFV600E, і ця мутація переважала у пацієнтів вікової групи <40 років. Однак ці параметри не мали статистичної значущості. Висновок: Згідно отриманих даних, мутація BRAFV600E достовірно частіше спостерігається у пацієнтів з інтрааксіальною пухлиною головного мозку, що може бути основою для подальших досліджень генетичних змін, які відбуваються під час прогресування пухлинного процесу у головному мозку у малайзійській популяції. Ключові слова: пухлини головного мозку, інтрааксіальні пухлини, мутація BRAFV600E, Малайзія. No Comments » Add comments |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Leave a comment