Materials of the II International Conference “Tumor and Host: Novel Aspects of Old Problem” (November 21–22, 2019, Kyiv, Ukraine)

INTERACTION OF USP1 PROTEIN AND РН DOMAIN OF BCR PROTEIN AND ITS ROLE IN BCR-ABL EVASION FROM PROTEASOMAL DEGRADATION

S.V. Antonenko, G.D. Telegeev

Institute of Molecular Biology and Genetics, NAS of Ukraine, Kyiv, Ukraine

antonenkoimbg@gmail.com

Introduction. Chronic myelogenous leukemia (CML) is characterized by the appearance of the cytogenetic marker of the Philadelphia chromosome (Ph), which is the result of translocation between 9 and 22 chromosomes. The product of this aberration is the hybrid oncoprotein Bcr-Abl.According to the preliminary results of the mass spectrometric analysis, 23 proteins were identified as potential candidates for interaction with the Ph domain of Bcr-Abl oncoprotein. The main function of ubiquitin specific protease 1 (USP1) protein is deubiquitination of cell proteins. As a result of deubiquitination, USP1 protein can prevent proteasomal degradation of Bcr-Abl oncoprotein in a cell and, consequently, contribute to its accumulation and progression of the disease.

Aim. To create the pCMVHA-USP1 genetic construct for eukaryotic protein expression and to determine the interaction of USP1 protein with the Рh domain of the Bcr-Abl oncoprotein.

Materials and Methods. The amplification of the coding sequence of USP1 gene was performed using primers USP1 fwd AATTGCCTGGTGTCATACCTAGTG and USP1 rev GAGAGACCAATAATATCCAGTAGC, pCMV-XL5-USP1 was used from the plasmid bank of the Department of Molecular Genetics of the IMBG NASU as a template. The resulting sequence of USP1 gene was ligated to pUC18 vector at Sma1 site. USP1 was subcloned to pCMVHA vector using Kpn1 and SalI restriction endonucleases.

Co-transfection of pCMVHA-USP1 and pmCitrineC1-PH plasmids into HEK 293T cells was performed using 3:1 ratio of μl PEI : μg DNA. Transfection mixture was added to HEK293T cells and grown for 24 hours at a temperature of +37 °C and 5% CO2. Co-immunoprecipitation of HEK293T cells was done using Sepharose G and anti-His antibodies (Sigma, USA). The results were visualized by Western blot analysis using anti-USP1 antibodies (Thermo Fisher Scientific, USA), anti-His (Sigma, USA).

Results and Discussion. Coding sequence of USP1 gene was amplified by PCR and ligated to the pUC18 vector. Genetic construct pCMVHA-USP1 for eukaryotic protein expression was created by sub-cloning the sequence of USP1 gene. Co-transfection of pCMVHA-USP1 and pmCitrineC1-PH vectors in HEK293T cells and co-immunoprecipitation assay revealed the interaction between USP1 protein and Ph domain of the Bcr-Abl oncoprotein.

Conclusions. Genetic constructs pUC18-USP1 and pCMVHA-USP1 have been created. For the first time, the interaction between USP1 protein and РН domain of the Bcr-Abl oncoprotein was shown. The results obtained are important for the understanding of signaling in this pathology and may be the basis for the development of new alternative methods of CML treatment.

ADSORPTIVE CARBON DRESSING FOR THE TREATMENT OF RAT MODEL WOUND AFTER CISPLATIN ADMINISTRATION AND GUERIN’S CARCINOMA GRAFTING

O.Yu. Babchenko, L.A. Sakhno, V.G. Nikolaev

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

helgadoctor@yahoo.com

Introduction. The metabolic intoxication and high systemic toxicity of cytostatic therapy affect the dynamics and character of the postoperative wounds healing in cancer patients, and, in particular, in those with purulent-inflammatory complications. In such situations, the use of adsorptive carbon dressing (ACD) that can absorb a number of toxic components from wound content and bind microbial cells seems relevant.

Aim. To study the effect of ACD on the healing rate of full-thickness cutaneous wound in rats after cisplatin (CP) administration, and on a complicated wound process in Guerin’s carcinoma-bearing rats after a CP course followed by tumor resection.

Materials and Methods. CP was administered to intact inbred rats at a dose of 1 mg/kg bw intravenously every other day (total dose 5 mg/kg). In two days, the animals were inflicted to full-thickness cutaneous wounds of 2.5 cm2 in size in the interscapular region. Gauze dressings were used in control and ACD in experimental group immediately after surgery. The rats were housed in separate cages. In the next group of animals, Guerin’s carcinoma was subcutaneously transplanted into the interscapular region. Three CP injections before and two ones after the surgical intervention for removing the tumor were administered. Closure and state of wounds were assessed via daily planimetry and photo-monitoring.

Results and Discussion. The healing terms of wounds in intact rats increased after the course of intravenous administration of СP not less than in 1.3 times (16.7 ± 0.5 vs 22.9 ± 3.0 days). Transient weight loss was observed on the background of CP. After 1–3 bandages in experimental animals, an “artificial black crust” was formed and remained on the wound until it was partially/completely epithelized. The wound surface area in CP-injected rats in 6 and 14 days after the wound infliction was respectively 1.7 and 4.1 times less under ACD than gauze dressings. The healing time for the wounds under ACD was 17.2 ± 1.5 vs 22.0 ± 3.6 days in control. A characteristic difference in the dynamics of the surface area changes of wounds after tumor resection is the absence of an increase in their size for the first three days under ACD, which is inherent for wounds after using gauze dressings. After three days, the average wound surface area in control animals (gauze dressing) was 1.21 times higher as compared with the initial one and vice versa 1.42 times lower under ACD. Visually, within this period, control animals showed swelling of the wound edges and hemorrhages, which were practically absent in experimental ones. Since the fifth day, the wounds in most rats in the experimental group were partially or completely covered with a dry black crust, signs of inflammation were absent. In 7–11 days after the tumor resection, in most rats in both groups tumor growth was resumed under or near the wound. The wounds protected with the crust formed by ACD continued to decrease in size for some time, but the secondary tumor growth lifted or shifted them, interfering the wound healing. The appearance of a wound infection in more than half of the animals in the control group was accompanied by a pronounced unpleasant odor. As a result, the maximum life span was 34 and 63 days, and minimum — 14 and 20 days in control and experimental animals, respectively.

Conclusions. Afterintravenous administration of CP in a total dose of 5 mg/kg bw, the healing term of full-thickness cutaneous wounds inflicted to intact rats was 1.3 times longer. The term of healing can be accelerated by applying the ACD. The use of ACD immediately after tumor resection in rats with Guerin’s carcinoma on the background of CP course allows to quickly stop bleeding during surgery and reduce traumatic edema in first days of postoperative period, reduce the risk of local infectious complications in conditions of recurrent growth of carcinoma. The results demonstrate the possibility of ACD use for the prevention and treatment of complicated wounds in cancer patients.

DIFFERENT IMMUNOPHENOTYPE OF TAMOXIFEN-RESISTANT AND TAMOXIFEN-SENSITIVE TUMORS

N. Babyshkina1, 2, T. Dronova1, 2, S. Patalyak1, E. Slonimskaya1, 3, N. Cherdyntseva1, 2

¹Cancer Research Institute, Tomsk National Research Medical Center, Tomsk, Russian Federation

²National Research Tomsk State University, Tomsk, Russian Federation

3Siberian State Medical University, Tomsk, Russian Federation

nbabyshkina@mail.ru

Introduction. Breast cancer stem cells may be involved in tamoxifen resistance by regulating different transduction pathways, including growth factor receptor networks.

Aim. To assess the correlation between stem cells markers CD326+CD44+CD24–/low and expression of growth factor receptor factors CD221 (IGF1R) and CD309 (VEGFR2) in breast tumor tissue of patients who developed distant metastasis or recurrence during the adjuvant tamoxifen therapy (a tamoxifen-resistant group) or were responsive to tamoxifen treatment (a tamoxifen-sensitive group).

Materials and Methods. Fresh breast tissue specimens were collected from 59 women with hormone receptor-positive primary breast cancer who had received adjuvant tamoxifen treatment at a dose of 20 mg/day for at least 5 years. Multicolor flow cytometry was used to evaluate the expression of CD326+CD44+CD24-/low, CD221, CD309 markers and their co-expression in two patient groups.

Results and Discussion. We showed a high expression of CD326+CD221+ as well as CD326+CD309+ markers in tamoxifen-resistant tumors. Co-expression analysis revealed that the population of CD326+CD44+CD24-/low cells were significantly associated with tamoxifen resistance (p = 0.049). The double-positive CD44+CD221+ population was more prevalent in the tamoxifen-resistant patients than in tamoxifen-sensitive group (38.4% vs 21.6%, respectively, p = 0.041). On the contrary, a tamoxifen-sensitive tumors contained the higher percentage of double-negative CD44CD221 cells compare to tamoxifen-resistant (35.7% vs 14.7%, respectively, = 0.036).

Conclusions. Our preliminary results suggest that the detection of breast cancer stem cells phenotype and their co-expression with growth factor receptor factors could be a useful for the prediction of tamoxifen response.

The study was supported by the Russian Scientific Foundation, grant № 19-75-30016.

INVESTIGATING THE CORRELATION BETWEEN TRANSFORMING GROWTH FACTOR BETA 1 (TGFβ1) LEVEL AND BLAST CELLS IN PERIPHERAL BLOOD OF ADULTS WITH ACYTE LYMPHOBLASTIC LEUKEMIA

V.A. Barilka1, V.L. Matlan2, S.V. Prymak1, O.O. Shalay1, V.E. Logynsky1

1State Institution “Institute of Blood Pathology and Transfusion Medicine of NAMS of Ukraine”, Lviv, Ukraine

2Danylo Halytsky Lviv National Medical University, Ministry of Health of Ukraine, Department of Hematology and Transfusiology, Lviv, Ukraine

virabarilka@ukr.net

Introduction. The acute lymphoblastic leukemia (ALL) prognosis is unfavorable. Only 30–40% of adults with ALL achieve long-term remission. Therefore, the thorough search for believable prognostic factors in predicting the course of the disease and therapeutic targets is under way. As well known, blood cells together with their leukemic precursors (blasts) in the peripheral blood of ALL patients are affected by environmental cytokines such as TGFβ1. TGFβ1 can be secreted by normal and leukemic cells and activate growth, survival and metastatic pathways of ALL.

Aim. To investigate the correlation between TGFβ1 level and blasts in peripheral blood of adults patients with ALL and to set its predictive value.

Materials and Methods. Peripheral blood (PB) specimens were obtained from 19 newly-diagnosed adults ALL patients (median age 52 years; range 16–74) and 15 age-matched healthy persons as control group. The diagnosis was based on cytomorphologic and immunophenotypic features of bone marrow aspirates. The concentration of TGFβ1 in plasma and primary culture of PB mononuclear cells (PBMC), which were predominantly presented by blasts, was determined with bioassay cell line CCL64, mink lung epithelial cells. TGFβ1 concentration was estimated in the connection with the blasts count in PB of patients.

Results and Discussion. The median of blasts count in PB was 53.0 (range 12–96). TGFβ1 concentration in plasma was 5.21 ± 0.80 ng/ml and exceeded that in healthy persons (2.11 ± 0.38 ng/ml; p < 0.05). TGFβ1 concentration in plasma was not depended on the degree of leukemic infiltration in bone marrow. However, the level of TGFβ1 in plasma had a negative correlation with hemoglobin content (r = –0.27), and counts of lymphocytes (r = –0.26), monocytes (r = –0.36), and platelets (r = –0.91). In patients who did not reach remission and died is several weeks since the diagnosis (n = 7), TGFβ1 concentration was highly correlated with blast count (r = 0.62) that indicated a significant proportion of cytokine production by the leukemic cell clone. Confirmation of such an opinion was given by measuring the concentration of cytokine in PBMC culture (7.36 ± 2.6 ng/ml), which exceeded TGFβ1 plasma level in ALL patients; p <0.001. The correlation coefficient between the TGFβ1 in the primary culture of PBMC and blast count was r = 0.26. TGFβ1 produced by PBMC of the patients with low hemoglobin level (< 100 g/l) was two times higher than that of patients without symptoms of anemia; p < 0.05.

Conclusions. Plasma TGFβ1 level was elevated in ALL patients. Increased TGFβ1 concentration in plasma of ALL patients was accompanied by increased blast count in РB and could have a negative influence on normal hematopoiesis with anemia, lymphopenia, thrombocytopenia, and resistance to treatment. The results obtained can testify the use of TGFβ1 assay to assess the course of the disease and point to the probable target for ALL treatment.

EPIGENETIC MECHANISMS OF UBIQUITINATION AND SUMOYLATION IN DISORDER OF SPERMATOGENESIS AND INITIATION OF CARCINOGENESIS IN THE TESTIS

S.V. Bazalytska, A.M. Romanenko

State Institution “Institute of Urology, NAMS of Ukraine”, Kyiv, Ukraine

bsvua@i.ua

Introduction. Epigenetic regulation is a complex process by which external factors interact with the genome without disrupting the nucleotide DNA sequence, including DNA methylation, effects of microRNA, post-transcriptional modification of histones due to their phosphorylation, acetylation, ubiquitination and sumoylation.

Aim. To study the role of the processes of ubiquitination and sumoylation in the regulation of spermatogenesis in male infertility as well as in the initial stages of carcinogenesis, including of patients living in regions of Ukraine contaminated with 137Cs.

Materials and Methods. Testicular biopsy specimens of 54 patients with obstructive and non-obstructive secretory forms of male infertility of “clean” and contaminated with 137Cs regions of Ukraine were studied as well as peritumoral tissue of 40 patients with germ cell tumors of the testis using histological and immunohistochemical (IHC) methods for study of the ubiquitin and ubiquitin SUMO proteins.

Results and Discussion. A significant increase in the IHC indices of cytoplasmic expression of ubiquitin in Sertoli cells in patients with blocked spermatogenesis and Sertoli cell syndrome was found compared with patients with preserved spermatogenesis (4.8 ± 0.17; 7.4 ± 0.6 and 2.7 ± 0.09, respectively, p ≤ 0.001). In Leydig cells, a significant increase in the cytoplasmic expression of ubiquitin and a simultaneous sharp decrease in its nuclear expression were found. In patients from areas of Ukraine contaminated with 137Cs, the intensification of ubiquitination processes was determined — a significant increase in the cytoplasmic expression of the ubiquitin in Sertoli cells, spermatogenic epithelium and Leydig cells compared to similar observations from “clean” regions. IHC expression of the ubiquitin SUMO correlated with certain patterns of the ubiquitin protein expression with overall low IHC indices. It was found that in peritumoral testicular tissue in the seminiferous tubules with blocked spermatogenesis, which constitute 95% of observations, in spermatogonia, spermatocytes and spermatids, as well as in Sertoli cells, ubiquitination process significantly increased (3.5–4-fold increase of IHC coefficient as compared with observations from “clean” regions and 2.5–3-fold increase as compared with observations from radiocontaminated regions), which indicates an intense process of proteolysis and post-translation modification of intracellular proteins.

Conclusions. The established patterns indicate the involvement of the epigenetic mechanisms of ubiquitination and sumoylation in the regulation of spermatogenesis and the participation of components of the ubiquitin-proteolysis system in the initiation of carcinogenesis, which can be induced by persistent long-term low doses of ionizing radiation in humans.

CONTENT OF CANCER STEM CELLS AND IMMUNOCOMPETENT CELLS IN GLIOMA INFILTRATION

L.M. Belska

State Institution “Romodanov Neurosurgery Institute, NAMS of Ukraine”, Kyiv, Ukraine

nimun.neuro@ gmail.com

Introduction. The role of stem and intratumoral immunocompetent cells in the development and progression of tumor is in the focus of current studies. Infiltration of central nervous system tumors with CD133+ cancer stem cells (CSC), macrophages/microglia, neutrophils, T-regulatory cells, etc. was shown. At the same time, many questions regarding their role in tumorogenesis remain unexplored, indicating the need for further research.

Aim. To investigate the level of infiltration of glial tumors of various degrees with CSC and immunocompetent cells.

Materials and Methods. 32 samples of glioma of varying degrees of malignancy were obtained from patients during neurosurgical operations. The phenotype of the cells was studied using monoclonal antibodies to CD3, CD4, CD8, CD16, CD133 molecules under the flow cytometry protocol (FACS Calibur “FC-500”, Beckman Coulter, USA) according to the Cytomics CXP Softwar program in accordance with the guidelines.

Results and Discussion. In glioma biopsies with high level CD 133+ CSC the number of cells with CD4+ phenotype was increased by 1.4 times and the number of CD8+ cells was reduced by 1.7 times compared to the gliomas with low content of CD 133+ CSC. There was no statistically significant difference between the relative content of CD16+ NK cells in glioma biopsies depending on the content of CD133+ CSC, however, in 43.5% of the samples, the level of NK cells was 1,3 times lower in biopsy samples with high content of CD133+ CSC.

In our opinion, this decrease in the number of effector cells (NK and cytotoxic T lymphocytes) may be due to TGF-β1 production by CSC, which results in inhibition of the expression of NKG2 CD8+ T and NK cells. It is impossible to exclude the indirect effect of CSC through T-reg cells on the proliferative potential of effector cells, since the production of CSC chemokine CCCL2 receptor for T-reg cells is described, which promotes the homing of T reg cells (CD4+CD25+) into glioma tissue. In our opinion, this assumption is confirmed by the increase in the content of cells with CD4+ phenotype in biopsy samples of glioma with high content of CD133+ CSC.

Conclusions. The level of cytotoxic immune cells in the tumor foci depends on the CSC content in the tumor tissue indicating the selective immunosuppressive properties of CSC.

MESENCHYMAL STEM CELL: REGULATION OF INNATE IMMUNITY CELLS

N.M. Berezhnaya

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

In 1978, Friedenstein et al. were the first who discovered in human bone marrow the cells that were previously unknown. These were adhesive non-hematopoietic fibroblast-like cells (“precursors of stromal mechanocytes”) that possess clonogenicity and high proliferative potential and can differentiate into various connective tissue lineages (osteoblasts, adipocytes, chondrocytes, myocytes and neurons). Later on, these cells were identified as mesenchymal stem cells (MSC) (A. Caplan) and such definition became generally accepted. Subsequently, MSC was a subject of thorough studies and copious information was accumulated on MSC role in adaptive immunity. Nevertheless, the role of MSC in functions of the innate immunity cells has been underestimated for a long time. Only recently, the novel data appeared shedding some light onto the regulatory function of MSC on such cells as neutrophils, macrophages, monocytes, microglia, and innate lymphoid cells. The effects of MSC on these cells are manifold and depend on biological features of these cells as well as their localization. For neutrophis, the predominant effects mediated by MSC are regulation of the recognition of non-self antigens, involvement in the inflammatory process, protection from apoptotic death (without phagocytosis and cytotoxicity). Unlike neutrophils, for the cells of microglia, the preponderant effects are manifested as modulation of immunologic phenotype in the brain and the induction of neurogenesis.

Analyzing the available data on the MSC effects on the phagocyting cells, the following may be noted: i) Interaction between MSC with each type of phagocyting cells is different; ii) The peculiar features of such interactions depend mostly on their localization; iii) there has been increasingly recognized that the permanent activation of neutrophils may facilitate the induction of the malignant transformation, especially in the setting of the chronic inflammatory conditions. The possibility of inducing the malignant growth in the association with neutrophil activation was demonstrated by H. Dvorak in 1970s of the past century. Such possibility was later confirmed by V.G. Pinchuk in Ukraine in ultrastructure studies.

The repost will disclose the particular features of the interactions of MCS with rather different types of phagocytic cells (both by their origin and by biological properties) such as neutrophils and cells of microglia. Unfortunately, the data on the role of phagocyting cells in the induction of the malignant growth is highly limited. Nevertheless, there are good grounds for further developments and expansion in this area that may be challenging for better understanding of the pathogenesis of cancer.

BRONCHOSCOPIC AND CYTOLOGICAL STUDIES IN THE CENTRAL GROWTH OF LUNG CANCER

L.S. Bolgova1, T.M. Tuganova1, O.I. Alekseenko1, A.O. Ponomarenko2

1National Cancer Institute, Ministry of Health of Ukraine, Kyiv, Ukraine

2National University “Kyiv-Mohyla Academy”, Kyiv, Ukraine

bolgova2006@ukr.net

Introduction. Lung cancer (LC) is still the most common neoplasm in men and has become more frequent in women in economically developed countries. According to the Bulletin of the National Cancer Register № 19 (2018), the incidence of LC in Ukraine is 60.3 in men and 13.5 cases in women per 100 thousand of population. Therefore, the study of diagnostics and histogenesis of LC remains relevant and important for improving the diagnosis the effectiveness of treatment.

Aim. The purpose of our work is to examine the dependence of the growth of central LC relative to the mucous membrane of the bronchi.

Materials and Methods. The cytological method and the method of bronchoscopy.

Results and Discussion. Fibrobronchoscopy and cytological examination of the specimens were performed in 14 patients with central LC who were surveyed and treated at the National Cancer Institute. According to bronchoscopic data, exophytic growth, compression of the thickened bronchus outside or the spread of tumor damaging 2–3 bronchi have been revealed. Depending on the spread of the tumor, the lungs of the patients under study were divided into 3 groups. The first group included 4 (28.6%) patients, in whom the tumor spread by more than 2–3 bronchi. In 3 (75%) of these 4 patients, penetration of the bronchial mucosa was noted, and in the bronchial scrapes the elements of cancer were noted. In the second group narrowing of 1–2 bronchi due to compression from the outside was observed in 5 (35.7%) patients. In four (80%) of these 5 patients, penetration of the tumor was observed in relation to the cylindrical epithelium. In the third group, only exophytic tumor growth was seen in 5 (35.7%) patients, and only in one patient of this group cancer cells were found in the scrapes examined from the surface of the tumor.

Thus, a fibrobronchoscopic examination and a cytological study of scrapes from the exophytic part of LC made it possible to state that in 8 (57.1%) patients cancer cells were found, indicating the penetration of the bronchial mucosal tumor. In 6 (42.9%) patients in the exophytic tumor scrapes only the cells of the cylindrical epithelium were found, that is, the tumor grew out of the bronchial mucosa.

Conclusions. The obtained results indicate that central LC may develop from the peribronchial part, namely from cells of type II pneumocytes that are branched in peribronchial glands.

GENOME INSTABILITY AND ENDOCRINE-METABOLIC HOMEOSTASIS IN ENDOMETRIAL CANCER PATIENTS

O.V. Brieieva1, S.V. Nespryadko2, L.G. Buchynska1

1R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

2National Cancer Institute, Ministry of Health of Ukraine, Kyiv, Ukraine

olha.brie@gmail.com

Introduction. The genotoxic influence of estrogen metabolites, especially 4-hydroxyestradiol (4OHE2), is considered as one of the key factors of hormonal carcinogenesis. It is believed that hormonal imbalance, metabolic disorders and inherited sensitivity to the genotoxic agents may have a significant impact on endometrial cancer (EC) pathogenesis. In this regard, studies on the relationship between endocrine and metabolic changes, family history features and genome instability in peripheral blood lymphocytes (PBLs) and tumor cells of EC patients are needed.

Aim. To assess DNA damage level and DNA repair efficiency in PBLs and tumor cells of EC patients in relation to the presence of obesity, menstrual function and a family history of cancer.

Materials and Methods. 106 EC patients were included in the study. DNA damage level in PBLs and tumor cells was evaluated by comet assay and expressed as the percentage of DNA in the comet tails (% tail DNA). DNA repair efficiency was determined by calculating the ratio between repaired and induced DNA damage after incubation of PBLs with bleomycin or 4OHE2 (%). Body mass index values of < 30 kg/m2 were considered as normal weight and ≥ 30 kg/m2 as obese.

Results and Discussion. It was revealed that in PBLs of obese EC patients, the level of baseline DNA damage was significantly higher than in women with normal weight (8.1 ± 0.9 and 5.0 ± 0.7% tail DNA, respectively, p < 0.05). A similar tendency was found for tumor cells of EC patients (28.2 ± 2.1 and 20.4 ± 2.4% tail DNA, respectively, p < 0.05). In addition, a significantly higher level of baseline DNA damage was detected in tumor cells of menopausal patients (27.3 ± 1.7% tail DNA) compared to women with regular menstrual cycles (15.5 ± 3.2% tail DNA) (p < 0.05). After incubation with bleomycin, the level of DNA damage in the PBLs increased to 96.6 ± 0.7% tail DNA, and the influence of 4OHE2 led to its rising to 39.9 ± 2.0% tail DNA. When analyzing the repair processes, lower DNA repair efficiency of bleomycin-induced damage was detected in menopausal women (44.9 ± 4.7%) than in patients with regular menstrual cycles (61.2 ± 3.7%) (p < 0.05). Furthermore, in PBLs of obese EC patients with a family history of cancer, reduced DNA repair efficiency of 4OHE2-induced damage versus patients with normal weight was observed (15.0 ± 8.8 and 31.2 ± 11.7%, respectively).

Conclusions. PBLs and tumor cells of obese and menopausal EC patients are characterized by an increased level of baseline DNA damage along with decreased DNA repair efficiency that may be modulated by a family history of cancer. The data obtained indicate the significant role of endocrine and metabolic changes in determining the level of genome instability in cells of EC patients.

ANAEMIA IN GASTRIC CANCER PATIENTS WITH OVERWEIGHT: ASSOCIATION WITH INTRATUMORAL CANCER-ASSOCIATED ADIPOCYTES, HYPOXIA AND ANGIOGENESIS

L. Bubnovskaya1, S. Merentsev2, I. Ganusevich1, D. Osinsky2

1R.E. Kavetsky Institute of Experimental Pathology, Oncologyand Radiobiology, NAS of Ukraine, Kyiv, Ukraine

2City Clinical Oncological Center, Kyiv, Ukraine

osinskysp12@ukr.net

Introduction. Anemia prevalence and incidence in cancer patients are high. Cancer-induced anemia has been identified as an adverse prognostic factor due to a link between preoperative hemoglobin level and tumor oxygenation as well as angiogenesis. The presence of anemia might reflect more aggressive tumor phenotype. Excess body weight and weight gain have been reported to increase independently the risk of several cancers. In the setting of overweigh and obesity, microenvironment of tumor with high density of cancer-associated adipocytes (CAA) plays a special role in tumor progression. Understanding the causal association by which anemia and obesity drive cancer progression is essential for the development of novel precision therapy for obese cancer patients.

Aim. To evaluate the relationship between anemia and high density of САА in tumor microenvironment in the setting of overweight.

Materials and Methods. A total of 125 patients (59 men and 66 women) with primary gastric cancer (GC) were enrolled into the study. No patients received chemotherapy or radiation prior to surgery. All patients were thoroughly informed about the study that was approved by the Local Ethics Committee. Anemia was defined as Hgb < 13 g/dL in males and Hgb < 12 g/dL in females. Hypoxia level was evaluated by 31NMR spectroscopy: if the phosphomonoester/inorganic phosphate (PME/Pi) ratio < 1.4, tumors were characterized as hypoxic, whilst if PME/Pi > 1.4, the state of weak hypoxia was stated. Tumor adipocytes have been calculated as Plin5+-cells that were detected by immunostaining as well expressions of VEGF, CD34 and MVD, assessed by the hot spot method. The body mass index (BMI) was calculated as weight (kg)/height2 (m2).

Results and Discussion. Preoperative anemia was detected in 54.3% patients with prevalence of moderate anemia. 36.6%, 48.4% and 86.4% of high CAA was determined in tumors of patients with BMI < 25 kg/m2, BMI 25–30 kg/m2 and BMI > 30 kg/m2, respectively. Probability of high density of САА (> median) in tumors of grade 1 obesity is increased by a factor of 8.84 (χ2 = 13.47, 95% CI 4.665–16.777, р < 0.001) as compared with patients with BMI < 30. In nonanemic patients, level of hypoxia is not associated with BMI. In anemic patients with BMI < 25 kg/m2, tumors were weakly hypoxic PME/Pi > 1.59 (satisfactory oxygenated). In BMI 25–30 kg/m2 tumors were more hypoxic (PME/Pi > 1.36), and in patients with grade 1 obesity (30–35 kg/m2), tumors were much more hypoxic (PME/Pi > 1.27). In anemic patients with BMI > 30 kg/m2, a probability that tumors are hypoxic increased by a factor of 7.13 (odds ratio 7.13, χ2 = 3.95, 95% CI 3.57–14.225, p < 0.05). The association between high density of CAA (> median) and high expression of VEGF in tumor was found: in 82.4% anaemic patients of grade 1 obesity with high CAA density, probability of high VEGF expression (> median) in tumor increased by a factor of 4.01 (OR 4.01, χ2 = 6.43, 95% CI 1.339–6.867, p < 0.05) as compared with patients with BMI < 30. Moreover, tumors of these patients were characterized by hypovascularization. In nonanemic patients, tumor vascularization was not dependent on BMI.

Conclusions. It was shown that preoperative anemia of patients with overweight and especially grade 1 obesity is associated with high САА density that enhances tumor aggressiveness. It may be relevant to take into account pretreatment anemia in therapeutic concept for cancer treatment in such groups of patients.

ANAEMIA IN GASTRIC CANCER PATIENTS: ASSOCIATION WITH INTRATUMORAL HYPOXIA AND ANGIOGENESIS

L. Bubnovskaya1, S. Merentsev2, I. Ganusevich1, D. Osinsky2

1R.E. Kavetsky Institute of Experimental Pathology, Oncologyand Radiobiology, NAS of Ukraine, Kyiv, Ukraine

2City Clinical Oncological Center, Kyiv, Ukraine

osinskysp12@ukr.net

Introduction. The treatment outcome of gastric cancer (GC) is still not satisfactory because of objective difficulties in diagnosis and prediction of tumor response to treatment as well as prognosis of disease outcome. Anemia has come to be viewed as a relatively common condition in patients with cancer with the actual incidence largely dependent on the type and extent of the malignancy and has also been identified as an adverse prognostic factor. It has been hypothesized that the presence of anemia might reflect a more aggressive tumor phenotype. Such factors as hemoglobin level, an expression of vascular endothelial growth factor (VEGF), microvessel density (MVD) reflect tumor oxygenation. A causative relationship between anemia — tumor hypoxia — tumor aggressiveness mediated by angiogenesis up-regulation is advocated but yet remains controversial.

Aim. To analyze the relationship between anemia, tumor hypoxia, and angiogenesis of GC patients.

Materials and Methods. A total of 112 patients (64 men and 48 women) with primary GC were enrolled into the study. No patients received chemotherapy or radiation prior to surgery. All patients were thoroughly informed about the study that was approved by the Local Ethics Committee. Anemia was defined as Hgb < 13 g/dL in males and Hgb < 12 g/dL in females. Hypoxia level was evaluated by 31NMR spectroscopy: if the phosphomonoester/inorganic phosphate (PME/Pi) ratio < 1.4, tumors were characterized as hypoxic, whilst if PME/Pi > 1.4, the weak hypoxia was stated. Expressions of VEGF, HIF-1 alpha, CD34 were detected by immunostaining and MVD, assessed by the hot spot method.

Results and Discussion. Preoperative anemia was detected in 48.7% patients with prevalence of moderate anemia: 10.9 g/dL (6.7–11.4 g/dL) — 45.4% and 9.5 g/dL (7.8–11.8 g/dL) — 54.5% in males and females patients, respectively. It was found that in anemic patients a probability that tumors are hypoxic increased by a factor of 3.0 (odds ratio 3.23, χ2 = 7.42, 95% CI 1.13–4.70, p < 0.01) and even more in female patients when anemia was less than 9.0 g/dL (odds ratio 4.48, χ2 = 5.99, 95% CI 2.270–9.97, p < 0.05) as compared to nonanemic patients; positive expression of VEGF was detected in 71.4% of cases with high number of VEGF-positive cells (> median, odds ratio 2.52, p > 0.05). There was a trend towards low level of MVD (< median, odds ratio 2.97, χ2 = 7.88, 95% CI 2.04–4.323, p < 0.01) in tumors of patients with pretreatment anemia being a sign of more depth of invasion. There was no significant correlation between MVD and hypoxia level, as well with VEGF expression, but direct correlation between hypoxia level and VEGF expression in tumor tissue (p = 0.027) was found. We failed to show the differences in HIF-1 alpha expression in tumors of anemic and nonanemic patients.

Conclusions. It was detected that pre-operative anemiaincidence in GC patients are high. The results obtained have clearly shown that anemia relates to tumor aggressiveness due to a link between preoperative hemoglobin level and tumor oxygenation, as well as with high level of VEGF expression and low tumor vascularization that characterize more aggressive tumors. Therefore preoperative anemia may be a sign of a destructive impact of a tumor on its host and an increased risk of failure independent of the treatment modality and may help to pave the way for more effective treatments.

ROLE OF THE COMPONENTS OF TUMOR MICROENVIRONMENT IN MODULATING PROGRESSION AND COURSE OF THE DISEASE IN PATIENTS WITH ENDOMETRIAL CANCER AND AGGREGATION OF ONCOPATHOLOGY IN FAMILIES

L.G. Buchynska, N.P. Iurchenko

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

laboncogen@gmail.сom

Introduction. Endometrial cancer (EC) is a multifactorial pathology with a significant contribution of the hereditary component and is heterogeneous in terms of phenotypic characteristics, both of tumor cells and microenvironment components. The presented features of malignant neoplasms, along with the components of tumor microenvironment underlie such indices of tumor progression as growth rate, angiogenic, invasive and metastatic potential, determining the variability of the clinical course of the disease. Therefore, the study of association of phenotypic features of tumors, their microenvironment and clinical and pathological characteristics of patients with EC accounting their genealogical status, remains the priority in terms of assessing the aggressiveness of the neoplastic process.

Aim. To identify the phenotype of tumor cells in EC patients with family history of cancer and evaluate its association with clinical course of the disease.

Materials and Methods. The study was performed on the samples of surgical material of 170 patients with EC of stages I–II (mean age 57.3 ± 0.8 years), using morphological, immunohistochemical and statistical methods.

Results and Discussion. It was found that in 20.5% of pedigrees of patients with EC there is an accumulation of malignant tumors of different genesis with a predominance (73.3%) of cancer of the organs of the female reproductive system and the gastrointestinal tract. In patients with EC with a family history of cancer, a significantly higher expression of tumor-suppressor proteins FOXP3 and р16INK4a, and a decreased expression of p53 and Ki-67 were observed, while the content of FOXP3+-intratumoral lymphocytes decreased in comparison with these indices in endometrial carcinomas of patients without aggregation of tumor pathology in pedigrees. A progressive increase in the expression of Ki-67 and p53 proteins in parallel with a decrease in the EC differentiation grade in both groups of patients was shown. It should be noted that the changes in the expression of inhibitors of two families of cyclin-dependent kinases р16INK4a and р21WAF1/CIP1 in tumors of patients depending on the burden of a family history of cancer were oppositely directed. In the endometrial carcinomas of the EC patients with a family history of cancer, an increase in expression of р16INK4a (by 20.3 ± 3.2%) and a decrease of p21WAF1/CIP1 (by 9.2 ± 3.0%) in G3 tumors was observed in comparison with G1 (by 12.4 ± 1.3% and 18.1 ± 2.2% respectively). For the first time, it was found that 5-year survival rate of the EC patients with family history of cancer is significantly higher (92.0%) compared with that of patients without aggregation of oncological pathology in pedigrees (73.0%, p < 0.05). It has been determined that the most informative prognostic markers of the favorable course of the disease in patients with a family history of cancer are low (< Me) content of intratumoral FOXP3+ lymphocytes and low (< Me) expression of the proliferation marker Ki-67.

Conclusions. On the basis of a complex clinical-morphological, genetic and molecular research, it was established that the biological polymorphism of EC of stages I–II is related to the genealogical status of patients with oncological pathology, the molecular tumor phenotype and factors of tumor microenvironment, which determines the degree of tumor malignancy and the course of the disease.

NO ASSOCIATION BETWEEN RS1899663 HOTAIR SINGLE NUCLEOTIDE POLYMORPHISM AND PROSTATE ADENOCARCINOMA METASTASIS IN UKRAINIAN POPULATION

Ya.D. Chumachenko1, A.D. Volkohon2

1Scientific Laboratory of Molecular Genetic Research of Sumy State University, Sumy, Ukraine

2Department of Surgery and Oncology, Sumy State University, Sumy, Ukraine

yaroslavus.dm@gmail.com, volkohon@ukr.net

Introduction. Non-coding RNAs (ncRNAs) implement a number of important cellular processes such as differentiation, proliferation, X-chromosome inactivation and imprinting. HOX transcript antisense RNA (HOTAIR) belongs to long ncRNAs and realizes epigenetic regulation of different genes expression. In physiological conditions it serves as a scaffold for lysine specific demethylase 1 (LSD1) and Polycomb repressive complex 2 (PRC2) that suppress HOXD gene cluster activity through Lysine (Lys) 4 demethylation and Lys27 trimethylation of histone H3 respectively. But current studies show that HOTAIR could activate androgen receptor and thus enhances proliferative and invasion properties of prostate adenocarcinoma (PA) cells. Moreover, it was found that G to T transversion (rs1899663) in HOTAIR gene changes the affinity of this lncRNA to various transcription factors related to progression and recurrence of different tumors, including PA.

Aim. To analyze the association between rs1899663 HOTAIR single nucleotide polymorphism (SNP) and PA metastasis in Ukrainian population.

Materials and Methods. Venous blood of 184 patients with diagnosed PA (80 subjects with metastatic foci and 104 individuals without metastasis) was collected for DNA extraction. Polymerase chain reaction-restriction fragment length polymorphism was used for rs1899663 HOTAIR genotyping. All statistical calculations were performed using Statistical Package for Social Science software (version 17.0, Chicago, IL, USA) and p < 0.05 was accepted as significant.

Results and Discussion. The following distribution of genotypes among PA patients with and without metastasis, respectively, was found: GG — 33.7%, GT — 53.8%, TT — 12.5%, and GG — 45.2%, GT — 44.2%, TT — 10.6%. But according to the χ2-test there was no significant differences in genotype frequencies (p = 0.291). Logistic regression analysis showed the lack of association between rs1899663 HOTAIR and PA metastasis neither in crude dominant, recessive, additive and over-dominant models of inheritance nor after the adjustment for age, smoking and drinking (p > 0.05). Nowadays a small amount of studies is devoted to the investigation of the association between rs1899663 HOTAIR and PA development. Taheri et al. showed the over-presentation of T-allele and TT-genotype among patients with PA compared to subjects with benign prostate hyperplasia. Thus, further population studies are necessary for the correct estimation of rs1899663 HOTAIR SNP and PA development.

Conclusions. There is no association between rs1899663 HOTAIR SNP and PA metastasis in Ukrainian population.

CHARACTERISTICS OF BREAST CANCER PROGRESSION

Yu.Ya. Chuprovska, A.S. Kondratova

Higher State Educational Institution of Ukraine “Bukovyna State Medical University”, Chernivtsi, Ukraine

chuprovska.julia@gmail.com

Introduction. Despite the rapid development of oncology, the prediction of breast cancer metastasis still remains a disputable and unexplored issue. A retrospective study of the characteristics of breast cancer progression will provide an opportunity to better understanding of the problem. This one can serve as the basis for further research aimed at identifying objective criteria for predicting breast cancer progression.

Aim. To study the clinical and statistical characteristics of the breast cancer course with the verified progression of the tumor process, depending on the stage of the disease and the molecular subtype of the tumor.

Materials and Methods. A retrospective analysis of 242 outpatient records of patients with breast cancer was carried out. The female patients, depending on the breast cancer progression after treatment, were divided into two groups: the first group consisted of 179 people “without breast cancer progression” and the second one — 63 (26.0%) people “with verified breast cancer progression”. The median age of the patients was 57.3 ± 0.69 years.

Results and Discussion. On the basis of the data obtained, it can be concluded that there is a clear dependency between the increase in the percentage of the patients with breast cancer progression and the stage of the disease. There is no significant difference as to the rate of progression between the two research groups accounting for median age, the frequency of the right or left mammary glands lesions, or the number of regional lymph nodes affected by metastases. The only distinctive feature was that in group with breast cancer progression, the percentage of patients with larger tumor size was higher. The longest period to verify the progression of breast cancer is common for stage II B of the disease, with the Luminal-A subtype of the tumor.

Conclusions. All of the listed: age, localization of tumors in the right or left breast, and the number of regional lymph nodes affected by metastases do not affect the breast cancer progression. Within, larger average tumor size is noted, especially with the Luminal-A subtype of the tumor. The longest period to verify the progression of breast cancer is common for stage II B of the disease, with the Luminal-A subtype.

ANTICANCER EFFECTIVENESS OF XENOVACCINES IN MOUSE TUMOR MODEL

A. Darinskas1, 2, J.A. Krasko1, 2, K. Žinioytė1, 3, V. Pašukonienė1

1Laboratory of Immunology, National Cancer Institute, Vilnius, Lithuania

2JSC Froceth, Vilnius, Lithuania

3Vilnius University, Vilnius, Lithuania

vita.pasukoniene@nvi.lt

Introduction. Immunotherapy in the form of anticancer vaccination relies on the mobilization of the patient’s immune system against specific cancer antigens. Instead of focusing on an autologous cell lysate, which is not always available in clinical practice, the present study investigates vaccines utilizing xenogeneic fetal tissues that are rich in oncofetal antigens and compares them with autologous vaccines. Lewis lung carcinoma and melanoma (B16)-challenged C57BL/6 mice were treated with xenogeneic vaccines made from chicken whole embryo, rat brain tissue, different sheep fetal organ antigens, supplemented with organic and synthetic adjuvants (Bacillus subtilis protein fraction, bacterial ghosts, azoximer bromide, meglumine acridone acetate, polyA-polyU).

Aim. To evaluate and compare the antitumour effectiveness of autologous and xenogenic vaccines in vivo in mouse melanoma and lung carcinoma models.

Materials and Methods. Follow-up of survival of tumor-bearing mice after vaccination with all different types of vaccines, evaluation of tumor growth and spread of metastasis, phenotyping of peripheral blood lymphocytes, histological evaluation of lung tissue.

Results and Conclusions. Xenogeneic vaccination can have a significant impact on survival of mice challenged with metastatic and non-metastatic cancer. Xenogeneic vaccines achieve higher survival benefit in mice than autologous lysate-based vaccination in metastatic cancer setting. Some xenogeneic vaccines require adjuvanation to achieve positive clinical outcome to increase the phagocytic capabilities of antigen presenting cells (PolyX adjuvant), whereas autologous lysate-based vaccines require adjuvanation to mitigate the immunosuppressive properties of tumor lysate (BGs platform). Adjuvanted autologous lysate-based vaccines and xenogeneic vaccines cause an increase in CD8+ lymphocyte count and contribute to smaller metastatic spread. CD8+ cell count strongly correlates with survival rate in mice vaccinated with autologous lysate-based vaccines or xenogeneic vaccines.

IMPACT OF RECEPTOR EPIDERMAL GROWTH FACTOR ON THE ENDOCRINE RESISTANCE IN LUMINAL BREAST CANCER PATIENTS

T.A. Dronova1, 2, N.N. Babyshkina1, 2, M.V. Zavyalova1-3, E.M. Slonimskaya1, 3, N.V. Cherdyntseva1, 2

¹Cancer Research Institute, Tomsk National Research Medical Center, Tomsk, Russian Federation

²National Research Tomsk State University, Tomsk, Russian Federation

3Siberian State Medical University, Tomsk, Russian Federation

tanyadronova@mail.ru

Introduction. It is well documented that the bidirectional cross-talk between estrogen receptor alpha (ERα) and growth factor receptor pathways plays an important role in the development of endocrine resistance.

Aim. To examine the relationship between mRNA level, protein expression and gene polymorphism of the epidermal growth factor receptor (EGFR) and ERα with endocrine therapy efficacy and prognosis in patients with luminal breast cancer.

Materials and Methods. The study included 141 breast cancer patients who had received adjuvant endocrine treatment (tamoxifen or aromatase inhibitors), of which 31 patients developed recurrence or distant metastasis after endocrine therapy (hormone resistance group), 110 patients did not develop any disease progression (hormone sensitive group). The EGFR (rs2227983, rs1468727) and ERS1 (rs2228480, rs2077647, rs1801132, rs3798577) SNPs were detected by a TaqMan assay. The relative expression of mRNA for EGFR and ESR1 was analyzed using RT-PCR analysis. EGFR protein expression level of was assessed by immunohistochemistry. Progression-free survival was evaluated using Kaplan — Meier analysis.

Results and Discussion. The mutant genotypes of ESR1 at both locus rs2228480 and rs3798577 were more frequent among hormone resistance group patients compared with to hormone sensitive group (p = 0.040 and p = 0.007; respectively). We identified a low ERS1 mRNA expression level in patients who developed distant metastasis or recurrence after endocrine in contrast to the distant metastasis-free patients (p = 0.015). A high EGFR protein expression level was associated with the endocrine resistance in breast cancer patients (p = 0.006). In addition, Kaplan — Meier analysis showed that the patients with EGFR positive expression level had a poorer progression-free survival than those with EGFR negative expression (log rank p = 0.048). Moreover, we demonstrated a significant relationship of both the ESR1 rs2228480 and ESR1 rs3798577 mutant genotype with poor survival of breast cancer patients (log rank p = 0.011 and log rank p = 0.020; respectively).

Conclusions. Our data suggest that genetic polymorphisms and ESR1 mRNA expression as well as EGFR protein expression level can be useful potential markers to select patients with luminal breast cancer who would benefit from adjuvant endocrine treatment.

The study was supported by the Russian Scientific Foundation, grant № 19-15-00151.

MONITORING MYOSIN IN LIGHT CHAIN PHOSPHORYLATIONS IN HELA CELLS

B.I. Gerashchenko

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

biger63@yahoo.com

Introduction. Diverse forms of cellular movement and shape changes including cytokinesis require the function of non-muscle myosin II (NMII), a major force-generating mechanoenzyme in the structure of actomyosin. Normally, NMII is regulated through phosphorylations on its ~20 kDa light chains (LCs). Deregulated NMII may contribute to cancer progression in the form of invasion and active division of cancer cells.

Aim. The current study is aimed to clarify cell cycle-dependent localization and expression of doubly phosphorylated LCs (serine-19 and threonine-18) that in comparison with singly phosphorylated LCs (serine-19) stimulates actomyosin ATPase activity to a remarkably higher extent.

Materials and Methods. Before use, the polyclonal antibody (PP1) against doubly phosphorylated LCs was characterized (Cytometry 2002; 47: 150–157). Actively dividing cells in suspension (HeLa S3) or adherent (HeLa) cultures were fixed and sequentially stained with the PP1 antibody (then with Alexa Fluor 488-labeled goat anti-rabbit IgG) and DNA-specific DAPI to microscopically estimate localization and expression of diphosphorylated LCs throughout cell cycle. To discriminate the population of PP1-positive cells, flow cytometry/cell sorting was performed on HeLa S3 cells. Sorted cells were examined for nuclear morphology.

Results and Discussion. Diphosphorylated LCs were highly expressed during mitosis, suggesting the positive role of diphosphorylation in redistribution of LCs between daughter cells and in cytokinesis. Interestingly, there were also binucleated cells (72% of all binucleated cells) in the fraction of positively stained cells. In light of the evidence that the cleavage furrow formation is independent of mitotic control (J Cell Biol 1995; 131: 191–205) and cell cycle position (J Cell Biol 2016; 213: 641–649) one can assume that some cells with aberrant cell division, such as binucleates, upon exit from mitosis still have myosin activated for subsequent cytokinesis. Proliferation of binucleates has been reported in many cell lines including HeLa (Exp Cell Res 1967; 48: 39–52, Cytotechnology 2016; 68: 1123–1130).

Conclusions. The level of immunofluorescence signals arising from the phosphorylated LC forms monitored with flow cytometry may provide a clue for investigating the mechanisms governing the function of NM during various cell motile events including cytokinesis. However, when the adherent cells are used, microscopy-base image cytometry seems preferable to avoid undesirable cell detachment procedures causing profound cytoskeletal rearrangements.

PROSTATE CANCER SUBTYPING BY GENE EXPRESSION CHARACTERISTICS OF TUMOR AND STROMAL CELLS

G.V. Gerashchenko, V.I. Kashuba

Institute of Molecular Biology and Genetics, NAS of Ukraine, Kyiv, Ukraine

anna.gerashchenko@ukr.net

Introduction. Carcinogenesis is a very complex process, involving not only primary cells under transformation, but also tumor microenvironment, which contain many cell types, such as fibroblasts, macrophages, endothelial cells, many types of immune cells, etc. All these stromal cells in the tumor microenvironment change their natural tumor suppressive properties to tumor supportive during carcinogenesis. Obviously, intercellular interactions influence not only the tumor growth, but also response of tumor cells to treatment and efficacy of anticancer therapy. Earlier we have established relative gene expression (RE) profiles of more than 50 genes, associated with prostate tumor cell characteristics (PCAG), cancer-associated fibroblasts (CAF), tumor-associated macrophages (TAM), several immune-associated genes (IAG) in prostate adenocarcinomas. We have found very high dispersion of RE (20 folds and more) and supposed not accidental character of RE changes and presence of different molecular subtypes.

Aim. To analyze RE profiles of prostate cancer and stromal markers to detect potential clinically significant molecular subtypes of prostate adenocarcinomas.

Materials and Methods. Quantitative PCR (qPCR) was performed in 37 prostate adenocarcinomas with different stages and Gleason score for 33 transcripts of PCAG, 8 CAF markers, 6 TAM markers, 9 IAG genes. K-means clustering were used to generate adenocarcinoma subtypes, considering clinical and pathological characteristics. Dunn — Bonferroni post-hoc test for multiple comparisons were conducted to determine RE differences between cancer molecular subtypes. The Spearman rank order correlation test was performed to establish correlations between clusters of different gene groups.

Results and Discussion. K-means clustering were performed for fore described gene groups. In all cases the program has generated 3 clusters with statistical significant RE differences between cancer subtypes and significant different stages. PCAG have RE differences between cluster for 21 transcripts from 33, among them AR, CDH1, CDH2, KRT18, PSA, PCA3, OCLN, PRL, PRLR, VDR et al. CAF markers have RE differences for 7 from 8 genes, for example, ACTA2, HIF1A, S100A4, CTGF. TAM markers have RE differences for all 6 genes and IAG group have RE differences between clusters only for 4 from 9 genes, namely IRF1, IL2RA, HLA-G, CTLA4. It should be noted, that two clusters contain adenocarcinomas of 1–2 stages with different PCAG molecular characteristics appropriate luminal and stem-like molecular subtypes, whereas the third cluster has advanced cancers with specific RE for some cancer-associated and stromal genes characterized the second luminal molecular subtype. The highest positive correlation between PCAG subtypes was found with CAF subtypes (rs = 0.82, p < 0.0001). Other stromal groups have the high positive correlations with PCAG too TAM (rs = 0.58, p < 0.001), IAG (r= 0.61, p < 0.001).

Conclusions. Defined three molecular subtypes of prostate adenocarcinomas and high correlated CAF and TAM molecular subtypes reveal about high relations between cancer cells and stromal characteristics in prostate carcinogenesis.

EXPRESSION OF CANCER-ASSOCIATED FIBROBLASTS AND MACROPHAGES AS POTENTIAL NON-INVASIVE MARKERS OF MELANOMA PROGRESSION

G.V. Gerashchenko, I.M. Vagina, Yu.V. Vagin, V.I. Kashuba

Institute of Molecular Biology and Genetics, NAS of Ukraine, Kyiv, Ukraine

vladimir.kashuba@ki.se

Introduction. Melanomas are highly malignant neoplasms, which consist of biologically different groups with different origin of cells, clinical and histological characteristics, profiles of metastasis, specific somatic mutations, etc. Each tumor type is a heterogeneous disease with certain molecular features of individual tumors, it is relevant to define both prognostic markers and disease progression, and markers for targeted therapy, immune system status and tumor and stromal clinical significant characteristics, less invasive methods than tissue biopsy or surgical tissues. Liquid biopsy analysis is the most noninvasive method for investigating gene expression under different pathological states of human and animals.

Aim. To determine and analyze relative expression (RE) levels of 15 genes which are specific for cancer-associated fibroblasts (CAF) and tumor-associated macrophages (TAM) and immune system in blood of mice with transplanted melanomas to identify potential markers of melanoma progression.

Materials and Methods. Quantitative PCR (qPCR) was performed for two groups of C57BL/6j mice: control and melanoma group with injected 2 • 105 cells of B16 melanoma. Tbp was used as a reference gene for qPCR normalization. On the 19th day after melanoma cells injection and formation of highly progressed tumors, blood samples were taken for analysis. Kruskal — Wallis and the Fischer exact tests with correction on multiple comparisons according to the Benjamini — Hochberg procedure with FDR = 0.2 were conducted to establish significant RE differences between experimental groups.

Results and Discussion. Establishing RE level showed that there are no highly expressed genes in mouse blood. All these genes have moderate and low expression levels. The statistical analysis of RE differences between melanoma and control groups identifies six genes with significant increased RE levels, which have 2-fold and more upregulated expression for CAF markers: Acta2, Cxcl14, Fap, and TAM markers: Cd68, Ccl22, Ccl17. We have detected a stable immunosuppressive state, as evidenced by decreased RE levels: Cd4, Cd3, Cd8, and significantly increased level of immunosuppressive marker Cox-2 in addition to the above-mentioned upregulated CAF and TAM markers. The appearance of TAM markers in the blood suggests the development of new mechanisms of cancer metastasis.

Conclusions. To prove CAF influence on mechanisms of melanoma progression and metastasis, it is necessary to study the expression of immune-associated and stromal genes in the dynamics of melanoma development.

OPTIMIZATION OF LABORATORY EXAMINATIONS OF PROFESSIONALS EXPOSED TO IONIZING RADIATION, WITH THE AIM OF PREVENTION OF RADIATION COMPLICATIONS AND RADIOGENIC TUMORS

O.A. Glavin1, E.A. Domina1, V.M. Mikhailenko1, L.I. Makovetska1, O.O. Hrinchenko1, L.A. Illyuchok2

1R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv

2National Cancer Institute, Ministry of Health of Ukraine, Kyiv, Ukraine

veterok61@ukr.net

Introduction. Professional contact with ionizing radiation is dangerous due to the imbalance of free radical processes, the occurrence of genetic damage and development of cancer of radiation genesis. Optimization of laboratory diagnostics of negative effects caused by professional contact with radiation sources should contribute to their timely prophylaxis and prevention.

Aim. To select informative laboratory tests to identify the negative effects resulting from professional contact with sources of ionizing radiation.

Materials and Methods. The blood samples of radiologists (45 individuals) and conditionally healthy donors (control group, 51 individuals) were analyzed using biochemical, cytogenetic and statistical methods. The content of sulfhydryl groups of proteins and peptides (SH-groups) and malonic dialdehyde (MDA) — the end product of lipid peroxidation were determined in blood plasma. Activity of enzyme catalase and the ratio of prooxidant and antioxidant processes (hydrogen peroxide induced chemiluminescence) were determined in blood hemolysates. The number of spontaneous chromosomes aberrations, total production of free radical compounds (the fluorescent probe with 2´,7´-dichlorofluorescin diacetate) and superoxide anion were determined in peripheral blood lymphocytes.

Results and Discussion. Among professionals exposed to low doses of ionizing radiation for up to one year, the level of chromosomal aberrations in lymphocytes increased 1.9-fold. In the case of longer contact with radiation sources (more than 1.5 years), the number of chromosomal aberrations in lymphocytes exceeded the average population level by 2.8 times. Those genotoxic effects were accompanied by an increased level of superoxide anion formation (1.6 times). At the same time, the total production of free radical compounds in lymphocytes remained at the level of the control group. Also in the blood of examined radiologists, the concentration of MDA increased by 1.5 times, the content of SH-groups was reduced by 1.7 times and there was a tendency to a decrease in catalase activity. In general, such changes in the blood of the examined professionals reflected the ratio of prooxidant and antioxidant processes (1.5-fold increase).

Conclusions. The results of these studies showed the presence of a significant risk of radiation-associated lesions in individuals associated with professional exposure to low doses of ionizing radiation, which may be associated with the predominance of oxidative processes. Based on obtained results, the best early markers to identify such negative changes will include the ratio of prooxidant and antioxidant processes and the SH-groups concentration in the blood. In case of significant deviations of these markers from the norm, subsequent cytogenetic studies might be performed.

RATIO OF INDICATORS REFLECTING STATE OF CONGENITAL AND ACQUIRED IMMUNITY IN PATIENTS WITH PITUITARY ADENOMAS, MENINGIOMAS AND GLIOBLASTOMAS AT VARIOUS CLINICAL STAGES

I.A. Gnedkova, A.A. Shmeleva, V.V. Vaslovych, M.A. Gnedkova

State Institution “Romodanov Neurosurgery Institute, NAMS of Ukraine”, Kyiv, Ukraine

irinagned53@ukr.net

Introduction. Previous studies have shown that in patients with glioblastomas the level of inflammatory reactions increases significantly at all clinical stages: in the preoperative, postoperative periods and with continued growth — neutrophils/lymphocytes (Nph/Lym) > 4, with meningiomas — in the postoperative period Nph/Lym 6.5 ± 2 17.

Aim. To assess the informativity of Nph/Lym ratio in patients with pituitary adenomas.

Materials and Methods. The absolute content of platelets (PLT), Nph and Lym in peripheral blood (PB) was counted on a MINDRAY BC-3000 plus automatic hematology analyzer in 18 patients with pituitary adenomas, 40 patients with glioblastomas, 25 with meningiomas. 28 non-oncological patients made up the comparison group. The PLT/Lym, PLT/Nph, Nph /Lym ratios were calculated.

Results and Discussion. In patients with adenomas of the pituitary gland, Nph/Lym ratio was not changed at all clinical stages as compared with the control group. In patients with continued growth of adenoma, Nph/Lym ratio was significantly lower than in the control group (1.3 ± 0.21 vs 2.18 ± 0.20). This fact is associated with an increase in the percentage of lymphocytes in the PB. Probably, the peculiar feature of pituitary adenomas is that pituitary hormones GH:STH and ACTH/propriomelanocortin (Pomc1)MCH have an anti-inflammatory effect — they enhance the synthesis of anti-inflammatory cytokines suppressing neutrophilia. Pituitary hormones have different effects on the immune system — they may exert both pro-inflammatory and anti-inflammatory effects. In this regard, the ratio Nph/Lym, which does not differ from the value of the comparison group, is the final indicator of the complex interactions between hormones and neuropeptides of the hypothalamic-pituitary-adrenal axis and pro-inflammatory and anti-inflammatory reactions of the immune system.

Conclusion. The Nph/Lym ratio reflects not only cell interactions between innate and adaptive immune system, but also is the result of complex interactions of hormones, neurotransmitters, neuropeptides of pituitary adenomashaving pro-anti-inflammatory effect on the immune system.

CHANGE OF IMMUNOLOGICAL INDICES IN DYNAMICS OF DEVELOPMENT OF EHRLICH CARCINOMA

A.M. Goltsev, N.M. Babenko, Yu.O. Gaevska, M.O. Bondarovych, T.G. Dubrava

Institute for Problems of Cryobiology and Cryomedicine, NAS of Ukraine, Kharkiv, Ukraine

cryopato@gmail.com

Introduction. Inflammation may be a prerequisite for the development of almost all types of cancer. At the same time, a number of immunotherapeutic strategies for treating oncological pathology are aimed at stimulating the immune system in the already formed tumor and often envisage enhancing the production of proinflammatory cytokines and stimulating the signs of classical M1 activation in macrophages. It is important to improve the recognition of oncological pathology development with the identification of a number of the marker signs that indicate the developmental phase of the oncology process and determines the choice of the optimal time for therapy to start. A convenient model for the analysis of such changes is Ehrlich carcinoma (EC).

Aim. There is scanty information about the dynamics of changes in immunological parameters during EC development, which was the purpose of this study.

Materials and Methods. EC was transplanted in BALB/c mice by intraperitoneal administration of 3 • 106 cells/mouse in 0.3 ml of saline. At 4, 7, 14 and 21 days, the volume of ascites, the number of tumor cells, and phenotype of cells of the monocyte-macrophage system (CD14+, i.e. a common marker of monocytes/macrophages, CD86+ M1 and CD206+ M2 macrophages) were determined. At the same time, the content of pro- and anti-inflammatory cytokines in ascitic fluid was evaluated using the standard Mouse Th1/Th2/Th17 Cytokine Kit (BD, USA) with a FACS Calibur flow cytometer (BD, USA).

Results and Discussion. Judging by the intensity of cell accumulation in ascitic fluid, the dynamics of EC growth is such as follows: 4 days corresponded to the latent lag phase, 7–14 days — to the log phase, and 14–21 — to the terminal phase of tumor development. At the same time, a certain staging was shown in the change in the cytokine content in ascitic fluid according to the phases of EC growth. The latent period (4 days) corresponded to a sharp increase in the production of all investigated cytokines (IL-2, IL-4, IL-6, TNF-α, IFN-γ, IL-17 and IL-10), which may reflect the activation of the cytokine-producing cells in response to EC cells. This was confirmed by a 3-fold increase in the number of CD14+ cells along with a rise in the content of both CD86+ and CD206+ cells. When switching from the lag phase to the log phase (7 days), there was a gradual decrease in the content of almost all the cytokines if compared to 4 days of EC growth, exceeding the control values in average twice. The number of CD86+ cells during this period, remaining statistically and significantly higher than the control, tended to decrease if compared with 4 days. The day 14 was characterized by a further decrease in the content of pro-inflammatory cytokines on the background of a statistically insignificant rise in the level of IL-4 and IL-10. The terminal phase (21 days) was characterized by a sharp increase in all detectable anti-inflammatory cytokines against the background of a decrease in the pro-inflammatory pool. In the period of 14–21 days, a significant decrease in the content of CD86+ cells was shown against the background of an increased number of cells expressing the CD206 marker.

Conclusions. In the dynamics of EC growth, there was a gradual shift in the profile of macrophages toward the M2 phenotype, accompanied by an increased production of anti-inflammatory cytokines.

DENDRITIC CELL IMMUNOTHERAPY IN LOCOREGIONAL RENAL CELL CARCINOMA: 5-YEAR FOLLOW-UP PERIOD

O. Gorbach, N. Khranovska, O. Skachkova, M. Inomistova, O. Voylenko, E. Stakhovskyi

National Cancer Institute, Ministry of Health of Ukraine, Kyiv, Ukraine

horbach.alex@gmail.com

Introduction. Surgical resection of locoregional renal cell carcinoma (RCC) still is curative for localized disease, but many patients eventually recur. As additional treatment, interleukin-2 and interferon-alpha were used in high doses for patients with RCC, but only a minority of patients obtained major clinical benefit from such treatment. Several randomized controlled trials of target molecular inhibitors (sunitinib, sorafenib and pazopanib) have been reported for locoregional RCC as adjuvant treatment, but only sunitinib was positive for its primary end point, progression free survival (PFS) by independent review, but without any overall survival efficacy. Immunotherapy based on checkpoints (ipilimumab and pembrolizumab) and/or dendritic cells (DC) show promising results in locoregional RCC adjuvant treatment.

Aim. To investigate the efficacy of DC based immunotherapy in patients with locoregional RCC and identify the immune parameters that may predict DC vaccine therapy efficiency.

Materials and Methods. Seventy patients with III–IV stage RCC were enrolled into the study. Patients were randomized into two groups: 1st — patients received DC immunotherapy as adjuvant treatment, 2nd — control group of patients who received surgery and IFNα therapy. Generated autologous DCs loaded with mechanically treated microparticles of tumor cells were injected intradermally at 2–4 • 106 cells per patient in 1–3 courses (6 months interval). One course consisted of five injections with one-month interval and immunological monitoring was performed before each injection.

Results and Discussion. DC based immunotherapy significantly increased 5-years PFS in patients with localized RCC. The 5-years PFS rate reached 57.7 ± 14.1% vs 15.9 ± 8.0% in DC immunotherapy and control groups respectively, with 70% reduction of the risk of metastatic disease in DC immunotherapy group (p = 0.019; HR = 0.30; 95% CI 0.18–0.79). Moreover, the median PFS was 11.9 months in the control group and the median PFS was not reached in DC immunotherapy group. According to Cox proportional-hazards model, we established association between CD16+ cell count in peripheral blood and PFS in patients with RCC after DC vaccine treatment (HR = 1.14; 95% CI 1.04–1.25; p = 0.004). Using ROC-analysis the optimal criterion > 28% for CD16+ cells in peripheral blood was identified (AUC = 0.79; p = 0.007), and this marker could be considered as a prognostic in DC vaccine efficacy. Patients with locoregional RCC with less than 28% CD16+ cells in peripheral blood after DC vaccine reached PFS to 53.8 ± 2.01% in 5-year period compared to 33.3 ± 2.55% PFS in patients, who had more than 28% CD16+ cells in peripheral blood after DC vaccine (p = 0.017).

Conclusions. DC based immunotherapy contributes to significant increase of 5-years PFS in patients with locoregional RCC. The count of CD16+ cells in peripheral blood after DC vaccine treatment was established as a prognostic marker of immunotherapy efficacy.

A NEW APPROACH TO THE TREATMENT OF GLIOBLASTOMA USING INHIBITION OF TUMOR-ASSOCIATED INFLAMMATION WITH LOW CONCENTRATION OF CALCIUM CHANNEL BLOCKER VERAPAMIL

N.Ya. Gridina1, A.N. Morozov1, V.D. Rozumenko1, Yu.V. Ushenin2

1State Institution “Romodanov Neurosurgery Institute, NAMS of Ukraine”, Kyiv, Ukraine

2V.E. LashkaryovInstitute of Semiconductor Physics, NAS of Ukraine, Kyiv, Ukraine

gridinanina@ukr.net

Introduction. Brain gliomas are among the most malignant human tumors with an unfavorable prognosis and a short postoperative survival averaging about 9 months. Breach of relationship between the mechanisms of reparation (the predominance of the inflammatory process) and regeneration (replacement of the defect with stem cells) can lead to the development of a tumor. Tumor growth begins when the transition of repair to regeneration is incomplete and the process of stem cell development is adversely affected by cells and factors of inflammatory genesis over a fairly long time. In the body, there are mechanisms of protection against such effects on stem cells as apoptosis, which dominates during embryonic development, and the epithelial-mesenсhymal transition. The study of the inflammatory process that accompanies the growth of malignant gliomas, called tumor-associated inflammation (TAI), becomes relevant. In our previous studies, a relationship was found between the increased inflammatory component and the increase in the degree of glioma malignancy. Therefore, the use of methods for inhibiting TAI in the postoperative period acquires considerable interest in order to prevent possible continued gliomas growth. Most anti-inflammatory drugs have a number of side effects and are not recommended for long-term use in patients with malignant tumors. Suppression of TAI can be accomplished by reducing the activity of ionotropic receptors, such as NMDA-receptors.

The structure of NMDA-receptors includes calcium channels. Calcium ions are essential in the development of the inflammatory process in many pathological processes including tumors. The action of ketamine (selecting blocker of NMDA-receptors) was more effective than verapamil, but long-term use of ketamine in the clinic can be dangerous. This indicates a link between the mechanisms of blocking calcium channels by verapamil and a decrease in the activity of ionotropic NMDA-receptors, due to the structural feature of the NMDA-receptor containing the built-in calcium channel. The inhibition of TAI using NMDA-dependent calcium blocker verapamil can help to slow the growth of glioblastomas, without causing toxic effects on the body with prolonged use.

Aim. To investigate the life expectancy of patients with glioblastomas in the distant postoperative period who were treated with verapamil hydrochloride in concentrations that minimize the level of blood cells aggregation in stage II of the inflammatory process.

Materials and Methods. 43 patients were divided into 2 groups, that received (group I) or who did not receive treatment (group II) with a calcium blocker using the example of verapamil hydrochloride in pills. For the objectification of the presence of TAI in the patient’s body, the aggregation of blood cells was examined with “Plasmon” sensor. The peripheral blood was collected to determine the indicators of aggregation of blood cells with the addition of various aqueous dilutions of verapamil hydrochloride (from 1:10 to 1:100,000). Patients took drugs at a dosage at which the level of blood cells aggregation was the lowest. Dosing of the drug was performed by reducing its concentration by a factor of 10,000. Of 43 patients admitted to the clinic, only 3 patients did not undergo chemotherapy. After the surgical removal of glioblastoma and the postoperative irradiation course, they only took verapamil hydrochloride at low concentrations daily.

Results and Discussion. In group I of patients undergoing combined treatment courses and taking verapamil, the average life expectancy was 18.6 ± 1.82 months and 8.47 ± 1.02 months in group II. Three patients without chemotherapy in the postoperative period received daily treatment with verapamil hydrochloride without interruption. All 3 patients continue to live for 19, 25 and 29 months, respectively. The effectiveness of such an approach to the treatment of glioblastomas can be compared with the data of other authors, in whom, with early diagnosis of primary glioblastomas and new medical tactics, the life expectancy of patients averaged only 15.3 months in postoperative period.

Conclusions. For the first time we present the results of the treatment of highly malignant glioblastomas with low concentrations of calcium channel blocker verapamil hydrochloride. The results indicate a high antitumor activity of the drug, both when used together with traditional methods of treatment or separately. The absence of toxic manifestations of the drug, an increase in the duration and improvement of the quality of life in patients with glioblastomas treated with low concentrations of verapamil hydrochloride in the late postoperative period was shown.

COLOCALIZATION OF BCR-ABL AND CORTACTIN IN K562 CELLS INDICATES THEIR POTENTIAL ROLE IN CLATHRIN-MEDIATED ENDOCYTOSIS

D.S. Gurianov, G.D. Telegeev

Institute of Molecular Biology and Genetics, NAS of Ukraine, Kyiv, Ukraine

dmitriy.gurianov@gmail.com

Introduction. Philadelphia chromosome is a result of t(9;22)(q34;q11) reciprocal chromosomal translocation, which leads to a fusion of BCR and ABL genes. The resulting chimeric protein BCR-ABL exists in three forms designated as p190, p210, and p230 according to their molecular weights. Each form is associated with different leukemia type: p190 is detected in acute lymphoblastic leukemia, p210 is a marker of chronic myelogenous leukemia, and p230 occurs during chronic neutrophilic leukemia. The reason of such differences in length and molecular weight is absence or presence of PH and DH domains of BCR protein in fusion protein BCR-ABL due to different chromosome breakpoints in BCR gene. Previous research (Miroshnychenko et. al., Experimental Cell Research, 2010) identified 23 potential interaction partners with PH domain of BCR. Since different types of BCR-ABL are associated with different phenotype of disorder, it is important to study the cause of such differences. Among 23 interaction partners, we have chosen cortactin (CTTN) for further investigation of its role in molecular pathways that promote certain phenotype of myeloproliferative disorders.

Aim. To determine intracellular distribution of CTTN and BCR-ABL in K562 cells.

Materials and Methods. K562 cells were grown in RPMI-1640 medium until cell number reached 106/ml. Cells were centrifuged at 1,000 g for 3 min at room temperature, washed 3 times in 1 ml PBS and fixed with 400 µl of fixation solution (4% paraformaldehyde, 0.1% Triton X-100 in PBS) for 20 minutes at room temperature. Fixation solution was removed and cells were washed 3 times with PBS. Cells were stained with rabbit anti-BCR and mouse anti-CTTN primary antibodies for 1 h at room temperature at 1:100 dilution in 20 µl PBS. Cells were washed 3 times with PBS and stained with Alexa-647 conjugated anti-rabbit and Alexa-555 conjugated anti-mouse secondary antibodies for 1 h at room temperature at 1:100 dilution in 20 µl PBS. Cells were washed 3 times with PBS and mounted on microscope slides in AF1 Citofluor antifade medium containing DAPI. Microscope slides were imaged on Carl Zeiss LSM 510 Meta confocal microscope. Colocalization analysis was performed in ImageJ JACoP plugin.

Results and Discussion. We detected statistically significant colocalization between BCR-ABL and CTTN in K562 cells with Pearson coefficient of 0.685 and Manders coefficients M1 = 0.557 and M2 = 0.633. Colocalization occurs in cell periphery near plasma membrane.

Conclusions. Colocalization between BCR-ABL and CTTN indicates that BCR-ABL may take part in cortactin-mediated invagination of membrane during clathrin-mediated endocytosis and affect downstream signaling pathways.

ADAPTOR PROTEIN RUK/CIN85 FUNCTIONS AS A SWITCH BETWEEN “GO” AND “GROW” STRATEGIES OF BREAST CANCER CELLS

I.R. Horak, G.V. Pasichnyk, D.S. Gerashchenko, A.A. Samoylenko, L.B. Drobot

Palladin Institute of Biochemistry, NAS of Ukraine, Kyiv, Ukraine

iryna.horak@gmail.com

Introduction. Uncontrolled proliferation and abnormal migration and invasion of cancer cells are two main characteristics of tumor growth. The “Go or Grow” hypothesis proposes that proliferation and motility are two mutually exclusive alternative processes that are consistently activated in cancer cells. Both cells division and migration/invasion are controlled by numerous signaling pathways, which are operated, directed and amplified by adaptor/scaffold proteins. One of them, named Ruk/CIN85, interacts with a number of proteins regulating cells proliferation, survival, motility, and adhesion (including Cbl, p85/PI3K, Dab2, Src, FAK, PHD, Pyk2, p130/Cas).

Aim. To investigate the role of adaptor protein Ruk/CIN85 in the control of breast cancer cells proliferation, adhesiveness, migration, and invasion.

Materials and Methods. As models, we used human (MCF-7) and mouse (4T1) breast adenocarcinoma cells with stable overexpression and knockdown of Ruk/CIN85. Proliferative potential of breast cancer sublines with different levels of Ruk/CIN85 expression levels was evaluated by direct cells counting, MTT-assay, and percent of Ki67-positive cells. Adhesiveness was estimated by the number of cells attached to ECM (collagen type I, fibronectin, etc.) during 30 min after seeding and by counting of floating alive cells. As well, expression levels of adhesion molecules were analyzed using qRT-PCR. Cells motility was evaluated by in vitro scratch assay, and invasion — using modified Boyden chamber.

Results and Discussion. It was demonstrated that Ruk/CIN85 overexpression in MCF-7 cells led to a 1.5–2 fold decrease in proliferation. Ruk/CIN85-overexpressed 4T1 cells were characterized by reduced proliferation by almost 2 times and by decreased percent of Ki67-positive cells by 2.5 times, while in 4T1 Ruk/CIN85-downregulated cells proliferative potential was increased. Adhesiveness to ECM components and number of live floating cells correlated negatively with Ruk/CIN85 expression levels in studied cells sublines. In 4T1 cells, negative correlation between Ruk/CIN85 and Tjp1, Icam1, Itgb1 expression levels was found. Simultaneously, Ruk/CIN85-overexpressing cells were characterized by increased motility (by 1.5 times for MCF-7 cells and by 1.6 times for 4T1 cells) and invasiveness (by 70 times for MCF-7 cells and by 4–5 times for 4T1 cells). In contrast, knockdown of Ruk/CIN85 led to decrease in motility and invasiveness of both MCF-7 and 4T1 cells. Thus, in the present study we demonstrated that changes in proliferation, adhesiveness and motility/invasiveness of MCF-7 and 4T1 cells were characterized by opposite direction depending on up/down Ruk/CIN85-regulation: low level of Ruk/CIN85 expression was characteristic for proliferative and adhesive, but weakly-invasive state, and high level of Ruk/CIN85 expression — for migratory/invasive state with attenuated proliferation.

Conclusions. The data obtained suggest that adaptor protein Ruk/CIN85 may function as a switch between “Go” and “Grow” strategies of breast adenocarcinoma cells depending on its expression levels.

REPROGRAMMING OF CANCEROUS CELLS AS A PROMISING APPROACH OF CANCER THERAPY

E. Kashuba1, 2

1R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

2Department of Microbiology, Tumor and Cell Biology, Karolinska Institutet, Stockholm, Sweden

Kashuba@nas.gov.ua

A stem cell can be defined as the unspecialized cell that is capable of dividing and renewing itself for long periods, i.e. infinitely. First, hematopoietic stem cells were isolated from bone marrow of mice and formation of colonies in the recipient spleen (recipients were irradiated mice) was demonstrated in 1962. Pluripotent stem cells are/could be a source for the “exchange” cells or tissues to treat many diseases, such as Parkinson’s and Alzheimer’s diseases, spinal cord injury, burns, stroke, heart disease, diabetes, osteoarthritis and rheumatoid arthritis. There are several clinical trials concerning stem cell therapies, such as HPC Cord Blood, LAVIV (Azficel-T), Fibrocell Technologies, Autologous Cultured Chondrocytes on a Porcine Collagen Membrane, HPC Cord Blood, Allogeneic Cultured Keratinocytes and Fibroblasts in Bovine Collagen, etc. Discovery of the induced pluripotent stem cells (iPSCs) started the new era of regeneration medicine. Despite a great progress, for example, in creation of insulin-produced cells from iPSCs in mouse models, there is a risk for development of tumors, especially, teratomas and others.

Certain features of stem cells show so called “cancer stem cell” (CSC), especially in hematological malignancies. There are markers, characterizing CSC in solid tumors, i.e. cells that possess the capacity to self-renew and to form heterogeneous lineages of cancer cells forming tumor (LGR5, CD133).

The solid tumor differentiation therapy is exemplified by treatment of sarcomas and liposarcomas by retinoids, histone deacetylase inhibitors and peroxisome proliferator-activated receptor-γ agonists. Another promising approach is the search for N-MYC inhibitors for neuroblastoma treatment.

We have found that concurrent expression of RB and high levels of mitochondrial ribosomal protein S18-2 immortalizes Rb1-null primary mouse embryonic fibroblasts that show many features of embryonic stem cells. The resulting cells can differentiate into adipocytes and also in osteogenic and chondrocyte lineages in vitro. The importance of precise regulation of S18-2 expression levels was studied during zebrafish embryo development. Knockdown of the S18-2 protein induced embryonic lethality and S18-2-depleted larvae exhibited a severely abnormal phenotype.

Together, our data suggest that S18-2 could be a potential and attractive target for the development of future cancer therapies.

TUMOR MICROENVIRONMENT CAN DRAMATICALLY CHANGE LEWIS LUNG CARCINOMA CELL SENSITIVITY TO ACTION OF ENERGY METABOLISM MODIFIERS

D.L. Kolesnik, O.N. Pyaskovskaya, I.V. Prokhorova, G.I. Solyanik

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

denkolesnik83@gmail.com

Introduction. Tumor cell metabolism is considered to be one of the hallmarks of cancer. This concept is exploited in development of new ways of anticancer therapy based on the use of substances capable of changing dramatically tumor cell metabolism. Among them sodium dichloroacetate (DCA), inhibitor of kinase of pyruvate dehydrogenase, and metformin (MTF), an antidiabetic hypoglycemic drug, an inhibitor of the mitochondrial respiratory chain (complex I) (both have been long used in clinical non-oncological practice), are of a big interest.

Aim. To investigate the efficacy of combined action of DCA and MTF against Lewis lung carcinoma cells in vitro and in vivo.

Materials and Methods. LLC/R9, Lewis lung carcinoma cell variant, was used. Effects of 30 mM DCA in combination with 2 mM MTF upon cell survival, cell cycle distribution, apoptosis, mitochondrial potential, intracellular ATP level, the glucose consumption rate, and lactate production rate were determined in vitro. In vivo antitumor and antimetastatic action of DCA in a total dose of 1 g/kg in complex with MTF in a total dose of 0.15 g/kg was studied. The state of mitochondrial electron-transport chain components in tumor cells was studied using electron paramagnetic resonance. Tumor-associated macrophages were estimated by flow cytometry with co-labeling for CD206 and CD68.

Results and Discussion. It was shown that MTF significantly enhanced LLC/R9 cell sensitivity to DCA in vitro. The half maximal inhibitory concentration (IC50) for DCA used in combination with non-cytotoxic 2 mM MTF was lower by 36% (p < 0.05) than that for DCA only. Combined action of DCA and MTF resulted in 40% (p < 0.05) decrease of viable tumor cell number, 2-fold (p < 0.05) decrease of proportion of cells in the S-phase, 4-fold (p < 0.05) increase of apoptosis and decrease (p < 0.05) of mitochondrial membrane potential of tumor cells. DCA lowered the glucose consumption rate and lactate production rate by tumor cells by 26.5% (p < 0.05) and 34.2% (p < 0.05) correspondently, whereas MTF withdrew these effects. Meanwhile, ATP level in tumor cells treated with DCA only and DCA in combination with MTF was by 35% (p < 0.05) higher than in the control.

In in vivo studies, tumor growth and metastasis indices in LLC/R9 bearing mice treated with DCA in combination with MTF did not significantly change from corresponding indices in control. The blood level of glucose and lactate in tumor bearing mice treated with DCA in combination with MTF were the same as in control. Besides, DCA in combination with MTF did not significantly affect the functional state of mitochondrial electron-transport chain of tumor cells. However, the number of CD68+ tumor-associated macrophages in mice treated with DCA and MTF simultaneously was lower by 43% (p < 0.05) as compared to control without significant changes in proportion of CD68+/CD206+ macrophages.

Conclusions. The efficacy of combined action of DCA and MTF against LLC/R9 cells in vitro did not correlate with their antitumor effect in vivo, whichgives support to significant role of tumor microenvironment in realization of antitumor action of energy metabolism modifiers.

A PUTATIVE USAGE OF EpCAM AS A DIAGNOSTIC MARKER FOR BREAST CANCER

L.M. Kovalevska, L.M. Shlapatska, E.V. Kashuba, V.F. Chekhun

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

Introduction. The breast cancer (BC) is quite aggressive disease that became relatively “younger” and affects more and more women of active working age. The mortality of the female population of Ukraine from this pathology exceeds 20%, and the number of new patients diagnosed with BC exceeds 15,000 each year. Hence, it is important, to find new markers for early and better diagnostics, as well as for prognosis of the outcome of the disease. In order to determinate the molecular subtypes of BC, we have chosen, among others, the Epithelial Cell Adhesion Molecule (EpCAM) molecule. EpCAM, or CD326, is a type 1 transmembrane glycoprotein with Mw 40 kDa. It is a marker of epithelial cells, characterizing their adhesion and activation properties. EpCAM is expressed on the basolateral surface of the plasma membrane of simple, transient and pseudo-multilayer epithelium cells and, under normal conditions, mediates cell growth and differentiation.

Aim. To determinate the expression pattern of EpCAM in BC cells and to analyze the relationship between the EpCAM expression levels and the molecular subtypes of BC.

Materials and Methods. For this study, monoclonal antibodies against EpCAM protein were developed. The BC tissues of various molecular subtypes from 38 patients were analyzed. For an analysis of the functional bonds (associations) of the EpCAM protein, the FunCoup database was used.

Results and Discussion. In all analyzed cases, we found differences in the EpCAM expression levels. EpCAM expression level in invasive duct carcinoma was higher than in invasive limb carcinoma. Moreover, the highest level of EpCAM expression was detected in the luminal A molecular subtype, and the lowest — in HER-2/neu (+) samples. Using bioinformatic methods for analyzing the functional bonds, we have found that EpCAM forms associations with four other proteins. The strongest functional relationship was detected between EpCAM and CLDN7 (claudin 7), which is involved in the formation of dense interactions between epithelial cells. The joint expression of EpCAM and CLDN7 RNA in experimental model systems (cell lines, mice) or in sections of the patient tissues indicates a significant functional relationship between these proteins. Also, a strong interaction was found with the proteins ATP1A1 and ATP1B1, Na+/K+ ATPases, which binds the EpCAM protein with a sodium-potassium pump of human cells. The weakest interaction was detected with the ubiquitinin C (UBC) protein, which plays a key role in maintaining the sustained amount of ubiquitin in the cell. In all bonds, there are no similarities of phylogenetic profiles.

Conclusions. Using the FunCoup database, we showed that the EpCAM protein is strongly associated with CLDN7, ATP1A1 and ATTR1B1 that are responsible for the adhesive properties of cells. This indicates a key role of EpCAM in the control of the architecture of epithelial tissue. Expression of the EpCAM was found in all analyzed tumor samples. The highest expression level of EpCAM was found in tumor cells of luminal A molecular subtype of BC. The expression pattern of EpCAM in tumor cells can be used as additional criterion for the establishment of molecular subtypes of BC for personalized therapy. This study was supported by of the Scientific Research Program of the National Academy of Sciences of Ukraine “Molecular Genetic and Biochemical Mechanisms for the Regulation of Cell and Systemic Interactions under Physiological and Pathological Conditions” (2017–2021) within the framework of the research work “Molecular Biological Factors of the Heterogeneity of the Malignant Cells and the Variability of the Clinical Course of Hormone Dependent Tumors” (2.2.5.411, 0117U002034).

RELATIONSHIP BETWEEN CHANGES IN THE THYMULIN, MELATONIN, CORTISOL AND T-LYMPHOCYTES BIORHYTHMS IN ONCOLOGICAL PATIENTS

I.F. Labunets1, 2, Yu.A. Grinevich2

1Institute of Genetic and Regenerative Medicine, NAMS of Ukraine, Kyiv, Ukraine

2National Cancer Institute, Health Ministry of Ukraine, Kyiv, Ukraine

irina_labunets@ukr.net, labklinimun@i.ua

Introduction. Circadian (daily) and circannual (season) rhythms of the functions cause adaptation of the living organisms to the changes in environmental lighting. The pineal gland, in particular melatonin, is a key regulator of immune system rhythmicity. The central immune organ, thymus, is the source of highly active hormone thymulin, which interactions with glucocorticoids possessing adaptive effects. In tumor-bearing body, a desynchronization of the immune-neuroendocrine interaction involving the above organs may occur.

Aim. The study of the biorhythmical activity of thymus, pineal gland, adrenal cortex and some indices of T-immunity in healthy subjects and in oncologic patients.

Materials and Methods. We examined healthy individuals and patients with skin melanoma, breast cancer, uterus chorioncarcinoma, cancer of esophagus and cardia (CEC), aged 20–60 years. Blood thymulin, melatonin, cortisol and T-lymphocyte count were measured with interval of 4 hours. The same indices were measured at 9.00 in spring, summer, autumn and winter.

Results and Discussion. The night time peak of thymulin level and its season fluctuations with the highest values in summer–autumn were registered in healthy subjects. In CEC patients we observed diminishing of the nocturnal peak of thymulin level or its monotonous rhythm. Disturbances of circannual fluctuations of thymulin level in cancer patients were characterized by the monotony (skin melanoma, breast cancer) or displacement of the seasonal acrophase (uterus chorioncarcinoma) from winter to spring and the decrease of thymulin level during some seasons. It appeared that circadian and circannual fluctuations in T-cell count correlated with the rhythmicity of thymulin level both in healthy people and cancer patients. In healthy people, the melatonin level increased in the evening and especially at night, whereas in the majority of cancer patients (CEC) its rhythmicity was monotonous or inverted. In the latter, the scope of daily fluctuations of cortisol level was considerably higher than in group of patients with activation of pineal gland function in the evening. In cancer patients, the seasonal fluctuations of melatonin level are monotonic and its values decrease. Disturbances of the circannual rhythms of melatonin and cortisol levels were interrelated. Noteworthy, the increasing thymulin level at night time in cancer patients is observed in the case of increased melatonin level. Disturbances of immune-neuroendocrine relations are registered already at the pretumoral stage and accelerated in tumor progression. We have also shown that in cancer patients aged 20–40 years the circannual rhythm of thymulin, melatonin and cortisol levels resembled the rhythmicity of healthy elderly individuals. These data evidence for the possible acceleration of age-associated changes of the biorhythms of these hormones in cancer patients.

Conclusions. Chronobiological investigations of the immunoneuroendocrine interactions in cancer patients are useful for the diagnosis, substantiation of risk factors and prognosis of tumor development. Melatonin, as a pharmacological agent, can be useful for restoring the disturbed rhythms of immune and endocrine system functions in the management of neoplastic disease. The schemes of melatonin administration should be based on age-related changes of sensitivity of above systems to its influence.

TUMOR AND NON-TUMOR STEM CELLS OF BRAIN TUMORS

N.I. Lisyanyi, L.N. Belskaya, D.N. Stanetskaya, A.N. Lisyany, A.I. Potapova, I.A. Gnedkova

State Institution “Romodanov Neurosurgery Institute, NAMS of Ukraine”, Kyiv, Ukraine

nimun.neuro@gmail.com

Introduction. The presence of tumor stem cells is characteristic of many tumors including the brain. Brain glioma tumor stem cells are able to induce the growth of tumors in immunodeficient animals. These tumors are characterized by radio- and chemoresistance, infiltrative growth and rapid relapse. Differential mimicry, infusion, and angiogenic potential are also characteristic of the stem cells of the gliomas. To realize their properties, tumor stem cells interact with the microenvironment of brain tissue and probably with other multipotent stem cells of the body.

Aim. To study the content of tumor stem cells (CD133+) and hematopoietic (CD34+, CD15+) and mesenchymal (CD90+) stem cells in brain tumors.

Materials and Methods. 115 samples of brain tumors removed during surgery were examined. Phenotyping of tumors was carried out after obtaining and standardizing a suspension of tumor cells. The suspension of tumor cells was obtained by mechanical homogenization of biopsy specimens. Phenotyping of cells was carried out using monoclonal antibodies against CD133 tumor stem cells (Millipore, USA) and non-tumor CD34, CD15, CD90 stem cells (Beckman Coulter, USA) according to the appropriate protocols. Statistical processing of the results was carried out according to the “Statistics 6.0” programs.

Results and Discussion. The highest content of CD133+ cells was found in glioblastomas and medulloblastomas, in astrocytomas I–II degree of anaplasia, the content of CD133+ cells was reduced by 2.0–2.5 times. It has been established that the content of tumor stem cells in malignant tumors varies from 2% to 25%, which is possibly due to the structural features of the tumor sample under study. In glial tumors, non-tumor stem cells CD15+, CD34+, CD90+ cells were detected. The greatest number of these cells was contained in gliomas of the III –IV degree of anaplasia. In astrocytoma of I–II degree of anaplasia, their content was 1.5–2.0 times less. The content of hematopoietic CD34+ cells in tumors was lower than the content of CD15+ cells.

Conclusion. Along with tumor CD133+ cells, glial brain tumors also contain non-tumor stem cells, which can participate in oncogenesis and contribute to the progression of tumor growth.

CMV CONTEINT IN BRAIN TUMORS OF DIFFENT HISTOGENESIS AND DEGREE OF MALIGNANCY

N.I. Lisyanyi, A.I. Klyuchnikova, L.N. Belskaya, A.N. Lisyany, D.N. Stanetskaya

State Institution “Romodanov Neurosurgery Institute, NAMS of Ukraine”, Kyiv, Ukraine

Introduction. Today, thanks to the use of molecular genetic and immunohistochemical methods, new data have emerged on the role of infection in oncogenesis, including the association of cytomegalovirus (CMV) with malignant brain tumors. It is known that CMV is detected in tumor tissue in many oncological diseases, but a single mechanism for stimulating carcinogenesis by this virus has not been established.

Aim. To establish the presence of CMV in brain tumors of various degrees of malignancy.

Materials and Methods. 256 samples of brain tumor biopsy material (123 gliomas, 51 meningiomas, 25 medulloblastomas, 16 oligodendroastrocytomas, 14 metastases and 27 others) were examined. The presence of CMV in the tumor tissue was determined by the molecular genetic method in the real time polymerase chain reaction (PCR) using the DNA-Sorb A and B kits, Amplisens (Russia on the BioRal instrument (USA) with standard kits for the determination of CMV DNA from the DNA-Technologiya firm (Russia). Immunofluorescent studies were performed on the cytological imprints of the tumor tissue indirect using the monoclonal antibody to pp-65 CMV protein using the MonoScan CMV Kit (Russia). In 60 neurooncological patients, the presence of CMV DNA was determined by real-time PCR. Statistical data were processed with Microsoft Excel.

Results and Discussion. Most often, CMV was detected in gliomas and medulloblastomas (33% and 20%, respectively), in meningiomas only in 5–7% of samples. Detection in brain tumors of CMV depends on the method of research — the immunofluorescence method determines the pp-65 CMV antigen 2–2.5 times more often than the DNA of the virus by PCR. In the blood of patients with brain tumors, the CMV DNA is not detected, which indicates an earlier contamination of the tumor focus by this virus.

Conclusion. The data obtained indicate a possible etiological or oncostimulating role of CMV in the development of 30% of malignant gliomas of the brain and the need to use immune and antiviral therapy to treat tumors containing CMV or its antigens.

PLATELETS OF BRAIN GLIOMA PATIENTS RELEASED MEDIATORS AFFECTING GLIOMA CELLS MITOTIC ACTIVITY IN VITRO

L.D. Liubich, L.P. Staino, N.I. Lisyanyi, T.A. Malysheva, D.M. Egorova, V.V. Vaslovych, L.A. Kot

State Institution “Romodanov Neurosurgery Institute, NAMS of Ukraine”, Kyiv, Ukraine

lyubichld@gmail.com

Introduction. Treatment of malignant brain gliomas remains a problem around the world despite comprehensive studies of the causes and mechanisms of their progression. Today no significant clinical progress in treatment of this brain pathology has been achieved due to invasive spread and multiresistance to adjuvant therapy methods. Recently, a pathogenetic role of inflammation and natural immunity in tumor progression has been in focus of the studies, namely tumor microenvironment-induced reprogramming of effector cells, especially major cell populations of peripheral blood. Among them platelets are considered as noninvasive biomarker for malignant glioma because of different granules content and release of microvesicles with numerous substances, which probably contribute to the tumor growth.

Aim. To study the effect of platelet-released mediators (PRM) in brain glioma patients on mitotic activity of experimental glioma C6 cells in vitro.

Materials and Methods. C6 glioma cells were cultured under the exposure to PRM of patients with glioma of different grades of malignancy (n = 10) as well as persons without overt somatic pathology (comparison group, n = 5). The diagnosis was verified with histological examination of degree of tumor malignancy (from G1 (1st degree) to G4 (4th degree). Platelets (1 • 109/ml) isolated from peripheral blood taken postoperatively, were passed through a filter (d = 0.2 μm) to obtain PRM-containing medium. After exposure to PRM for 72 h in cell cultures the mitotic index (MI) was calculated. The study of blood parameters was performed on an automatic hematological analyzer.

Results and Discussion. C6 glioma cells upon cultivation retained ability to mitotic division and revealed signs characteristic in malignant brain gliomas, particularly pathological forms of mitoses. After exposure to PRM of patients with gliomas G1–G3, MI in C6 cultures was 1.4–1.5-fold reduced (p = 0.003 — 0.01, Kruskal — Wallis test). In contrast, after exposure to PRM of patients with glioma G4, MI in C6 cultures increased 1.26-fold, (p = 0.000001, Kruskal — Wallis test as compared with gliomas G1–G3). After exposure to PRM of persons from comparison group, MI did not differ from control index. Thus, the PRM opposite effects on cell mitotic activity in glioma C6 cultures were revealed: enhancing impact of PRM of patients with high-malignancy gliomas (G4) and inhibitory impact of PRM of patients with gliomas G1–G3. Multiple comparisons by Kruskal — Wallis test of cell populations content in the peripheral blood with indices of persons from comparison group revealed the characteristics of systemic inflammation in glioma patients: increased numbers of leucocytes (2.6-fold, p = 0.036), neutrophils (3.4-fold, p = 0.023), neutrophil-to-lymphocyte ratio (4.1-fold, p = 0.021). Pairwise comparisons by Mann — Whitney U-test showed the raise of the peripheral blood content of leucocytes and neutrophils in glioma G4 patients compared to indices of persons from comparison group (p = 0.032, p = 0.016), while the lymphocytes count decreased (p = 0.05), and neutrophil-to-lymphocyte ratio enlarged (p = 0.016). The essential changes of platelet-to-lymphocyte ratio and monocyte-to-lymphocyte ratio where not found in studied samples of peripheral blood of glioma G4 patients. Obtained results are in general compliance with known data evidencing that in brain tumors of different histogenesis changes in the cells of various hematopoiesis lineages are observed that are more pronounced with the increase in tumor malignancy degree.

The revealed effects of PRM of glioma patients indicate that platelets secrete a spectrum of agents with ability of systemic influence, supposedly tumor-associated RNAs and pro-angiogenic, pro-tumor growth factors capable of regulating the cell cycle and proliferative activity of tumor cells in different manner depending on the degree of tumor malignancy.

Conclusions. The obtained data prove the major role of platelets in the brain glioma pathogenesis. The further research may contribute to the disclosure of new mechanisms for glioma “evasion” from immune surveillance and the search for fundamentally new approaches to immune therapy.

COMBINED BRCA1/2, CHEK2 AND TP53 GENE MUTATIONS ANALYSIS IN PATIENTS WITH FAMILY HISTORY OF BREAST CANCER

O. Lobanova1, Z. Rossokha2, O. Popova2, V. Cheshuk1, R. Vereshchako1

1Bogomolets National Medical University, Kyiv, Ukraine

2State Institution “Reference Centre for Molecular Diagnostic of Ministry of Health of Ukraine”, Kyiv, Ukraine

ol.lobanova@gmail.com

Introduction. Germline mutations in the BRCA1/2 genes account for the principal high-penetrance breast cancer (BC) susceptibility. Their prevalence in different populations has been previously reported. Additionally, rare mutations in CHEK2 and TP53 genes have been associated also with hereditary predisposition to BC and discussed last time as BRCA-ness mutations. But the frequency of their combinations and clinical significance of combined detection is not good indicated.

Aim. To evaluate the prevalence of BRCA1/2 (185delAG, 5382insC, T300G, 6174delT), CHEK2 (1100delC, IVS2+1>A, I157T), TP53 (G119C) genes mutations and their combination in patients with family history of BC.

Materials and Methods. Peripheral blood of 119 women (aged 47.59±1.01) with BC were tested for progenitor mutations in BRCA1/2 (185delAG, 5382insC, T300G, 6174delT) genes, BRCA-ness mutations in CHEK2 (1100delC, IVS2+1>A, I157T) and TP53 (G119C) genes using allele-specific PCR and PCR-RLFP. This analysis prospectively evaluated the clinicopathological parameters of 119 patients with BC and malignancies family history when underwent treatment between 2013 and 2017.

Results and Discussion. BRCA1 (5382insC) gene mutation was detected among 17 (14.3%) cases of 119 BC patients. CHEK2 gene mutations were found compared with detected BRCA mutation twice less — only in 9 (7.6%) patients: IVS2+1G>A — 2 (1.7%) cases; I157T — 7 (5.9%) cases. ТР53 (G119C) gene mutation was identified in 63 (52.9%) cases. Combined BRCA1 (5382insC) and ТР53 (G119C) genes mutations were defined in 8 (6.7%) patients and in 1 (0.8%) patient were combined BRCA1 (5382insC) and CHEK2 (I157T) genes mutations. Combined CHEK2 and ТР53 (G119C) genes mutations were defined in 1 (0.8%) patient with mutation in CHEK2 (IVS2+1G>A) gene and in 4 (3.4%) patients with mutation in CHEK2 (I157T) gene. BC in combined BRCA1 and ТР53 genes mutations carriers was triple negative (TNBC) and was associated with decreasing overall survival after development of brain metastases. However, BC in BRCA1 gene mutation carriers without ТР53 gene mutation was not only TNBC but luminal B type and was not observed so aggressive course of the disease without differences in treatment. BC in combined BRCA1 and CHEK2 or TP53 and CHEK2 genes mutations carriers was frequently ER/PR-positive with favorable course.

Conclusions. Combined BRCA1, CHEK2, TP53 genes mutations determine disease course in patients with BC, regardless of treatment standard used. It is necessary to analyze combinations of mutations to predict the disease course and create a personalized treatment strategy. We support the use of multigene panel testing in diseases cases with hereditary predisposition to BC.

TUMORS AND BLOOD PLASMA OF ANIMALS WITH WALKER-256 CARCINOSARCOMA

N.Yu. Lukianova1, Yu.V. Lozovska1, L.A. Naleskina1, I.N. Todor1, I.M. Andrusyshyna2, A.P. Burlaka1, V.F. Chekhun1

1R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

2State Institution “Yu.I. Kundiev Institute of Occupational Health”, NAMS of Ukraine, Kyiv, Ukraine

Introduction. Today it is known that lactoferrin (LF) influences in many ways the most important processes in the body in normal state and under carcinogenesis. However, the morphologic structure of tumors, the profile of different metabolic units at the tumor and organism levels, namely, homeostasis of essential elements (EE), enzymes of pro/antioxidant balance, and energy metabolism parameters, have not been fully understood.

Aim. To investigate the modifying effect of exogenous LF on the architectonics of tumors in the in vivo system, the content of EE (Cu, Zn, Mg, Fe, Ca), energy metabolism indices (glucose, lactate) and the changes in the activity of metal-containing enzymes (ceruloplasmin (CP), myeloperoxidase (MPO)) in blood plasma (BP) and tumor tissue (TT).

Materials and Methods. Analysis of morpho-structural features of TT, including its vasculature, was performed on rats with Walker-256 carcinosarcoma exposed to LF in the doses of 1 and 10 mg/kg of body weight. The EE content was determined by inductively coupled plasma atomic emission spectroscopy, CP activity was evaluated by electron paramagnetic resonance (EPR), and MPO — by a unified biochemical method.

Results. It was shown that exogenous LF at the doses of 1 and 10 mg/kg b.w. inhibited tumor growth by 44% (p < 0.05) compared to the control. Morphologically upon LF treatment tumor cells are characterized by segregation, pycnotic changes, hyperchromatosis of the nuclei, the phenomena of necrobiosis and necrosis, and as a consequence — reduction of the tumor lesion. The most pronounced changes were observed in tumor vasculature: dilation, thinning of vascular walls, hemorrhage. In the TT, LF caused a decrease in the content of Ca (1.8 times), Fe (1.2 times), Zn (1.4 times), with a more pronounced effect when applying a dose of 10 mg/kg b.w. At the same time, this dose changed the bioenergetic phenotype of tumors by reducing the content of glucose and lactate by 1.2–1.4 times. In animal BP, the treatment with LF caused a decrease in the content of Ca and Fe, but had opposite effect on the content of Zn; also, in LF-treated animals increased CP activity (1.2 times) and MPO (1.3 times) in BP were registered.

Conclusions. The analysis of the obtained data allowed establishing the mechanisms that lead to inhibition of tumor growth and changes in the tumor vasculature upon the action of LF at the mentioned doses. It is proved that EE and the state of some enzymes of the pro/antioxidant system play a key role in these processes.

ON THE PROBLEM OF THE DEFINITION OF BIOCHEMICAL PREDICTORS OF NON-MALIGNANT CELLS IN ONCOLOGICAL PATIENTS

L.I. Makovetska, E.A. Domina, M.O. Druzhуna

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

tsigun@ukr.net

Introduction. The irradiation of healthy tissues during the radiation therapy due to the primary cancer can be the cause of not only radiation complications, but also secondary cancers. The majority of secondary cancers develop in the tissues that are characterized by high radiosensitivity. Although these tissues do not differ by their structure from the normal tissues, they nevertheless display some metabolic changes. A question rises as to which biochemical changes occur in normal tissues of cancer patients and how they influence the mechanism of radiosensitivity formation according to the dose of irradiation as compared to the healthy control. Therefore, the determination of predictors of radiosensitivity in normal cells of cancer patients is of a high importance for decreasing the complications of radiotherapy.

Aim. To determine the intensity of free radical processes in the blood of donors depending upon the doze of irradiation in the conditions in vitro.

Materials and Methods. Blood samples of donors were irradiated in the range of 0.5–3.0 Gy. The intensity of free radical processes was assessed by the content of malonic dialdehyde (MDA) and the prooxidant — antioxidant ratio (PAR) analyzing hydrogen peroxide induced chemiluminescence.

Results and Discussion. For the first time, the linear relationship between in vitro test irradiation and radiation-induced biochemical changes in PAR and MDA levels has been demonstrated in the peripheral blood of conditionally healthy persons. The interindividual variability of the values of these indicators was detected. It has been shown that the level of MDA increased to 172% with an increase in radiation dose to 3.0 Gy. At the same time, the changes in the PAR are approximated by the linear equation of two types: with an increase (up to 136%) of the values and a decrease (up to 57%), which may indicate a different protective potential of human peripheral blood cells and the effectiveness of its implementation and thus individual radiosensitivity.

Conclusions. The results obtained at the first stage of the research are the basis for determining the biochemical predictors of radiosensitivity of non-malignant cells of cancer patients, who undergo radiotherapy.

METHYLATION STATUS IN PROMOTER REGION OF RUNX3 GENE AMONG WOMAN WITH BREAST CANCER DEPENDING OF AGE

N. Medvedieva1, O.Lobanova2, Z. Rossokha1, V. Vershyhora1, L. Ivanets1, V. Cheshuk2, R. Vereshchako2, N.G. Gorovenko3

1State Institution “Reference Centre for Molecular Diagnostic of Ministry of Health of Ukraine”, Kyiv, Ukraine

2Bogomolets National Medical University, Kyiv, Ukraine

3P.L. Shupyk National Academy of Postgraduate Education, Kyiv, Ukraine

refcentre2013@ukr.net

Introduction. Disruption of gene function regulation is associated with an increased risk of cancer. Methylation status of promoter region in gene regulates its expression. The Runt-related transcription factor 3 (RUNX3) gene is a member of the family DNA-binders RUNX transcription factors which are involved into oncogenesis. The RUNX3 gene is functioned as an oncosuppressor, thus it activates the antioncogene ARF-p21 pathway expression and induces apoptosis. The RUNX3 gene inactivation has been observed by researchers in various types of cancer caused by promoter gene area hypermethylation and protein structure change with impaired function. Methylation status of promoter region in RUNX3 gene is less well studied in breast cancer (BC) comparing with BRCA1/2 genes mutations or methylation.

Aim. To study methylation status in promoter region of RUNX3 gene among BC patients depending on their age.

Materials and Methods. Molecular genetic analysis of methylation status in promoter region was defined among 60 women with BC. Average patient age was 52.44 ± 1.59 years. There were 17 patients under 40 years (group 1) and 43 patients over 41 years (group 2). Peripheral blood and/or tumor tissue obtained during surgery were used as biological material. DNA extraction was performed using “Quick-DNA MiniprepKit” (ZymoResearch). DNA sample were frozen until bisulfide conversion via “EZ DNA Methylation-Gold Kit” (Zymo Research). Converted DNA was used for performing PCR-analysis via methyl-specific primers. Availability product analysis of methyl-specific PCR was performed using agarose gel electrophoresis. Statistical analysis included Fisher’s test.

Results and Discussion. Hypermethylation in promoter region of RUNX3 was found in 25 (41.66%) of 60 BC patients BC. 12 (70.58%) of 17 patients of the group 1 and 13 (30.23%) of 43 patients of the group 2 had hypermethylated status in promoter region of investigated gene. We defined significant differences between identified hypermethylated status depending on patients age (p < 0.05). Hypermethylation level of genes increases with age. But we specified in our investigation that RUNX3 gene activity involved in BC development in younger women as one of molecular pathways in disrupted antioncogene processes.

Conclusion. Hypermethylation status in promoter region of RUNX3 may be an early and/or diagnostic marker of decreasing apoptotic processes and tumor transformation. The direct detection of hypermethylation status in promoter region of RUNX3 in the tumor focus will allow in the future to establish new pharmacogenetic approaches to the treatment. Thus, clinic interpretation of the gathered results is required for defining strategy of the next researches.

SPECTRUM OF SOMATIC MUTATIONS IN PATIENTS WITH NON-SMALL-CELL LUNG CANCER: USING THE TECHNOLOGY OF NEXT GENERATION SEQUENCING IN THE REPUBLIC OF BELARUS

E.P. Mikhalenko1, A.N. Shchayuk1, O.M. Malysheva1, M.N. Shepetko2, V.G. Lebetsky3, V.I. Ltokhin4, A.V. Kilchevsky1

1Institute of Genetics and Cytology, NAS of Belarus, Minsk, Republic of Belarus

2Belarusian State Medical University, Minsk, Republic of Belarus

3City Clinical Anatomopathological Bureau, Minsk, Republic of Belarus

4Healthcare Institution “Minsk City Clinical Oncologic Dispensary”, Minsk, Republic of Belarus

anna.shchayuk@tut.by

Introduction. Non-small-cell lung cancer (NSCLC) constitutes 85% of all lung cancer types. Due to the development of a personalized approach to the treatment of patients, a study on the molecular genetic characteristics of a tumor, which allows to predict the development and course of the disease and optimize individual antitumor therapy, is of great importance.

Aim. To study somatic mutations in NSCLC patients, who live in the territory of Belarus using the next generation sequencing technique.

Materials and Methods. 101 patients with NSCLC diagnosis receiving a treatment inMinsk City Clinical Oncologic Dispensary from 2012 to 2018 was brought into our research (78 men and 23 women). 50 patients with NSCLC and 50 with adenocarcinoma formed the group. DNA sample preparation was performed at the MiSeq (Illumina, USA) device using TruSeq Amplicon Cancer Panel in accordance with the producer’s user manual.

Results and Discussion. After filtering conducted by exclusion of all low-quality variants (reading depth < 50; alternative allele frequency < 15%; variants that failed to pass the PASS-filter), a total of 86 variants of somatic mutations were obtained for 101 tumor samples — 0.85 variants per tumor on average. In cases of adenocarcinoma, somatic mutations were most commonly detected in the genes EGFR (25.5%), KRAS (17.6%), TP53 (9.8%), ATM (7.5%), CTNNB1 (5.7%), STK11 (5.7%) and in the genes TP53 (26.0%), ATM (14.0%), FBXW7 (8.0%), FGFR3 (6.0%), JAK3 (6.0%), RET (6.0%), APC (4.0%), EGFR (4.0%), PIK3CA (4.0%) in cases of NSCLC.

Analysis of the association of the studied somatic mutations and the development of a certain histological type showed that mutations of EGFR and KRAS genes are associated with the development of adenocarcinoma (OR = 9.08; 95% CI 1.94–42.48; p = 0.003 and OR = 10.50; 95% CI 1.28–86.37; p = 0.02, respectively). There is an increase in the frequency of occurrence of TP53 gene mutations in patients with NSCLC (OR = 3.23; 95% CI 1.06–9.89; p = 0.06). Among the carriers of EGFR gene mutations, women predominate: the mutation rate in women was 56.5% and in men only 3.8% (OR = 32.50; 95% CI 7.87–134.26). Somatic mutations in the KRAS gene were detected in 10 patients, found only in men (12.8%) and were not found in women. Somatic mutations in the TP53 gene were found predominantly in men (21.8%) and only in one woman (4.3%).

At the next stage, studies are conducted to determine the clinical significance of the identified mutations in the prognosis of a course of the disease.

VARIABILITY OF POLYAMINE METABOLIC BALANCE DURING TUMOR DEVELOPMENT

O.A. Orlovsky, S.P. Zaletok

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

orlovaleks1955@ukr.net

Introduction. Inhibitors of the enzymes of the polyamine (PA) biosynthesis and back-conversion are known as a kind of the effective anticancer remedies. But optimization of such “antipolyamine” therapy may be achieved only if we know real conditions of the enzymatic reaction balance variability in the PA metabolic system during the tumor development. The end expression of this enzymatic balance is a pattern of the PA spectrum in the tumor tissue and in the biological fluids of the tumor-bearing organism.

Aim. To compare the PA spectrum patterns variability during experimental and clinical tumor development.

Materials and Methods. PA spectrum patterns were studied during three kinds of experimental chemical carcinogenesis (N-nitrosodiethylamine liver carcinogenesis; 1,2-dimethyl hydrazine large and small intestine carcinogenesis) in rats as well as in the operational materials and urine of the patients with mammary, lung and rectal cancer. PA content in the biological materials was measured by the methods of thin-layer chromatography and HPLC, ornithine decarboxylase (the key enzyme of the PA biosynthesis) activity — by radiometric determination of 14CO2 production and/or chromatographic determination of putrescine production. Student’s t-test and, in need, Fisher’s exact method were used for statistical data treatment.

Results and Discussion. Statistically significant modulations of PA spectrum were discovered during all kinds of tumor development having been studied. The modulation patterns were found to be significantly different dependently on the kind of tumor. Because of ambiguity of the PA spectrum mapping into the set of the enzyme balance stages (each pattern of PA spectrum may be obtained in two or more combinations of the enzyme activities), real optimization of the “antipolyamine” therapy requires detailed enzymological investigations.

Conclusion. Our results demonstrate significant and tumor-kind-dependent modulations of the PA balance during tumor development. This fact has to promote special enzymological investigations having a goal to optimize anticancer therapeutic schemes including the PA metabolism modulators.

CANCER-CELL-EXOSOMES AS NOVEL DEVISE FOR ANTI-CANCER VACCINE DEVELOPMENT

V. Pašukonienė1, A. Darinskas1, 2, M. Gritėnaitė2, 3, G. Kundrotas1, 2, J.A. Krasko1, 2, K. Žinioytė1, 4

1Laboratory of Immunology, National Cancer Institute, Vilnius, Lithuania

2JSC Froceth, Vilnius, Lithuania

3Department of Immunology, State Research Institute Centre for Innovative Medicine, Vilnius, Lithuania

4Vilnius University, Vilnius, Lithuania

vita.pasukoniene@nvi.lt

Introduction. The immune system is critical in fighting cancer. Dendritic cells (DCs) are the major antigen-presenting cells and play a central role in cancer immunity. Nevertheless, tumors have the means of suppressing in vivo DCs function. Exosomes are extracellular vesicles acting as mediators in cell-to-cell communication and influencing biological functions in the recipient cells. However, biological roles of tumor-secreted exosomes on DCs remain largely unexplored. We hypothesize that tumor-derived exosomes might transfer tumor information which could be recognized in vitro by DCsto induce antitumor responses after transplantation.

Aim of this study was to investigate DC activation properties of exosomes secreted by different tumor cell lines, apply them for the treatment of mice with induced tumors, provide a functional comparison between different DC vaccines and evaluate mice survival.

Materials and Methods. Exosomes were isolated from murine tumor cell lines B16, Lewis lung carcinoma cells (LLC) and mesenchymal stem cells by ultracentrifugation or sequential filtration methods. Exosomes were identified by flow cytometry and dynamic light scattering analysis. Immature DCs were prepared from murine bone marrow cells. Maturation of DCs pulsed with lipopolysaccharide and tumor cell line secreted exosomes were evaluated by flow cytometry. Mice with transplanted LLC tumors were treated with different combinations of DC vaccines and exosomes alone.

Results and Discussion. Both isolation protocols yield a population of nanoparticles up to 300 nm in size. Extracellular vesicles affect expression of DC activation markers in a dose-dependent manner. DC vaccines and exosomes show moderate effects on mice survival.

Conclusions. Sequential filtration is a quick, simple and effective method for isolation of exosomes with the capacity to induce non-inhibitory DCs. DCs loaded with exosomes show therapeutic effect thus opening new ways for the development of more efficient anti-cancer advanced therapy medicinal products.

IN VITRO AND IN VIVO SYSTEMS FOR STUDIES OF BRAIN METASTASES

Y. Persidsky1, I.A. Krizbai2

1Department of Pathology and Laboratory Medicine, Temple University School of Medicine, Philadelphia, PA, USA

2Institute of Biophysics, Biological Research Centre of the Hungarian Academy of Sciences, Szeged, Hungary

yuri.persidsky@tuhs.temple.edu

Introduction. The majority of brain malignant tumors are metastases from tumors outside of the central nervous system (CNS). Mechanisms of their establishment remain elusive and new methodologies are needed to study this process and design preventive strategies.

Aim. To develop in vitro and in vivo models for studies of tumor cell interactions with the blood brain barrier (BBB).

Materials and Methods. We have developed in vitro models of the BBB using primary human brain microvascular endothelial cells (BMVEC) and primary human brain pericytes cocultured on trans well inserts. These are key cellular components of BBB. These models demonstrate low permeability and high trans-endothelial electrical resistance, similar to functional BBB. We have established a “cranial window” system in mice with cannulae allowing injection of stimuli playing roles in cell adhesion to and migration across the BBB in real time in live animals (by intravital microscopy/video recording). This system permits semi-quantitative assessment of the number of cells adhered/migrated across the BBB.

Results and Discussion. We used a novel in vivo model of localized aseptic encephalitis–meningitis in which TNFα was introduced intracerebrally and surveyed cerebral vascular changes and leukocyte-endothelium interactions by intravital videomicroscopy. We used inhibitors of poly (ADP-ribose) polymerase-1 (PARP, widely utilized in cancer treatment) which also possess anti-inflammatory effects. PARP suppression significantly reduced leukocyte adhesion to and migration across brain endothelium in cortical micro-vessels. PARP suppression in an in vitro model of the BBB enhanced barrier integrity and augmented expression of tight junction proteins. PARP inhibition in BMVEC diminished human monocyte adhesion to TNF-activated BMVEC (up to 65%) and migration (80–100%) across BBB models. Our prior work also demonstrated that activation of cannabinoid type 2 receptor (CB2) decreased adhesion of leukocytes to the BBB in vivo and in vitro and diminished barrier permeability in neuroinflammation. The mechanisms of extravasation of tumor cells are highly uncharacterized, but in some aspects recapitulate the diapedesis of leukocytes. We found that activation of CB2 receptors with agonist reduced the adhesion of melanoma cells to brain endothelial cells. Further, CB2 agonist decreased the transendothelial migration rate of melanoma cells.

Conclusion. We tested establishment of CNS metastases using in vivo and in vitro models and potential approaches to prevent them.

FUNCTIONAL ACTIVITY OF BLOOD CIRCULATING PHAGOCYTES AS A PREDICTOR OF THE EFFECTIVENESS OF ANTITUMOR ACTION OF DOXORUBICIN

I.V. Prokhorova, G.I. Solyanik

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

oncom@online.ua

Introduction. It is known that blood components carry information about the general physiological state of the body. That is why blood can be considered as a convenient test-system for the study of many tumor variables. This is particularly true for monocytes and neutrophils, which quickly respond to endogenous and exogenous factors including humoral factors produced by malignant tumors.

Aim. To study the phagocytic activity and reactive oxygen species (ROS) level of peripheral blood neutrophils and monocytes in rats with the transplanted Walker carcinosarcoma.

Materials and Methods. The research was conducted on female Wistar rats 2.5 months old weighing 185.0 ± 13.8 g, bred in an animal facility at R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine. In the study, two variants of Walker 256 carcinosarcoma were used: the parental strain and its variant resistant to doxorubicin (DOX). Phagocytic activity and ROS level in neutrophils and monocytes were evaluated by flow cytometry (BD FACSCalibur™, USA) using inactivated and FITC-labeled Staphylococcus, and 2’,7’-dichlorodihydrofluorescein diacetate (Sigma-Aldrich, USA), respectively. Statistical analysis of the data was performed using descriptive statistics, Mann — Whitney U-test using Statistic and Microcal Origin software.

Results and Discussion. It was shown that two variants of Walker carcinosarcoma differed in their sensitivity to DOX. After 6 consecutive daily therapy of DOX, the tumor volume of the parental variant decreased by 61% (p < 0.05), while the volume of DOX-resistant variant showed only a tendency to decrease. The growth of the resistant tumor caused a significant increase of the percentage of phagocytic monocytes (by 445% and 162.7%), the absolute count (by 445% and 162.7%) and the intensity of phagocytosis (by 16.6 and 14.4 times) compared with the corresponding indices of intact rats and rats with the parental variant of the tumor. Taking into account the simultaneous increase of the phagocytic monocyte counts, one may conclude on the polarization of these cells against the background of the development of the DOX-resistant tumors.

Without the impact of Walker parental variant on functional activity of neutrophils, DOX-resistant strains growth correlates with more than a fourfold increase (p < 0.05) level of ROS production and more than the doubling rate (p < 0.05) of the percentage of phagocytic cells compared to the parental strain. Moreover, against the background of a significant decrease in the level of ROS-generating monocytes in the blood of animals with DOX-resistant tumors, the cytotoxic activity of these cells increases compared with the parental variant by 86% (p < 0.05). This indicates a significant intensification of the generation of radicals in each phagocytic cell.

Conclusions. Our study provides evidence that the quantity and the phagocytosis intensity of monocytes, as well as the intensity of ROS production by monocytes and neutrophils, may reflect the degree of sensitivity of the tumor to DOX, and the increase in these indices could serve as a predictor of the formation of tumor drug resistance.

HEPATOPROTECTIVE EFFECT OF PLACENTAL ADHESIVE CELLS IN MODEL OF CYCLOPHOSPHAMIDE-INDUCED CYTOTOXICITY

O.V. Prokopiuk1, N.M. Pasieshvili1, V.Yu. Prokopiuk2, V.G. Karpenko1

1Kharkiv Medical Academy of Postgraduate Education, Kharkiv, Ukraine

2Institute for Problems of Cryobiology and Cryomedicine, NAS of Ukraine, Kharkiv, Ukraine

v.yu.prokopiuk@gmail.com

Introduction. Hepatotoxicity is a severe complication of chemotherapy, which reduces the quality of life of the patients. Rehabilitation after cancer treatment remains an urgent task of modern medicine. Cells and other placental derivatives are promising candidates for treatment of a number of dystrophic diseases and can be used in treatment of cancer patients (Silini A.R. et al., 2017). Possibility of placental cells application for chemotherapy complications treatment is not well investigated.

Aim. To investigate the chemoprotective effect of placental adhesive cells in in vitro model of cyclophosphamide-induced cytotoxicity.

Materials and Methods. Mouse placental cells were obtained by enzymatic method. Cyclophosphamide-induced cytotoxicity was modeled in fibroblasts and hepatocytes cell cultures derived from 20-days mouse embryos. Hepatocytes were selected to evaluate the organ parenchyma, fibroblasts — to evaluate its stroma. After the adhesion, the cells were kept in a medium with cyclophosphamide. To form the model, the concentration of cyclophosphamide was adjusted from 0.5 to 20 mM. After the action of cyclophosphamide in an optimal concentration, the medium was changed to medium, conditioned with mouse placental cells, at concentration of 2 • 105/ml for 24 hours. Cell cultures were evaluated by MTT test and morphologically.

Results and Discussion. We found that the effective concentration of cyclophosphamide for the model is 10 mM. The metabolic activity of the cells was reduced significantly and cells began to lose adhesion. Nevertheless, these changes were reversible and did not cause cell death. After the culture with 10 mM cyclophosphamide overnight, the MTT index of cultures of hepatocytes and fibroblasts was reduced by 30–40%. Morphologically, fibroblasts and hepatocytes decreased in size, losing partially their adhesion. After exposure to placental cells conditioned medium, fibroblasts and hepatocytes increased they metabolic activity by MTT test, and cell adhesion returned.

Conclusions. Medium conditioned with adhesive placental cells has a hepatoprotective effect in vitro.

ANALYSIS OF PIK3CA MUTATION IN PATIENTS WITH LOCALLY ADVANCED BREAST CANCER

A.O. Pryvalova, I.O. Vynnychenko, O.I. Vynnychenko

Medical Institute of Sumy State University, Sumy, Ukraine

privalova_nastya@ukr.net

Introduction. Genetic mutations are among the key elements of the molecular mechanisms of cancer. PIK3CA gene mutations are not an exception. Such mutations lead to the activation of the signaling pathway PI3K/Akt, which is involved in the cellular processes of various types of cancer, including breast cancer.

Aim. To investigate PIK3CA gene mutation in patients with locally advanced breast cancer at different treatment stages.

Materials and Methods. In the study, 12 patients with locally advanced breast cancer are enrolled. The diagnosis of breast cancer was verified by the results of a tumor tissue biopsy with immunohistochemistry. All patients were fully screened. Treatment was prescribed according to standard clinical protocols. All patients signed a voluntary informed consent for participation in research. Investigation of PIK3CA gene mutation was performed using a digital PCR on QuantStudio 3D Digital PCR System device (Thermofisher Scientific). On screening, formalin-fixed and paraffin-embedded tumor tissue samples were used for analysis. Then, PIK3CA mutation was tested in circulating tumor DNA (ctDNA) from patients with detected PIK3CA mutation in the tissue. Quantitative detection of mutation was performed every 2 cycles of neoadjuvant chemotherapy and after surgery on the 1st and 5th days. Each sample collection for the PCR complemented the standard list of clinical and laboratory procedures and computed tomography (CT).

Results and Discussion. All patients with detected PIK3CA mutation in the tumor tissue had the same mutation found in the corresponding ctDNA from the plasma. Thus, the mutation rate of the PIK3CA gene in patients with locally advanced breast cancer is 25% (3/12). 2 of 3 patients with detected PIK3CA mutations were ER-positive, 1 of 3 patients was ER-negative, nobody was HER2-amplified. Investigation of serial plasma samples during treatment of patients with locally advanced breast cancer demonstrated a decrease of ctDNA count during all cycles of neoadjuvant chemotherapy and after surgery. The lowest concentration was observed on the 1st and 5th day after surgery, in one patient — on the 5th day ctDNA was completely absent. Response evaluation was compared with CT data and the comparability of the results was found. Further collection and analysis of samples is planned, as well as the inclusion of more patients in the study.

Conclusions. At this stage, it can be concluded that the determination of PIK3CA mutation in tumor tissue is comparable to the determination of this mutation in ctDNA of plasma using a digital PCR. Also, the determination of PIK3CA mutation from ctDNA can provide additional information about the dynamics of the disease and response to treatment in patients with locally advanced breast cancer and may be used as an additional diagnostic method in combination with CT.

Funding. This research has been performed with the financial support of the Ministry of Education and Science of Ukraine grant № 0118U003570 “The efficiency of “liquid biopsy” and tissue biopsy in the diagnosis and treatment of malignant tumors”.

ORNITHINE DECARBOXYLASE PROSPECTS FOR USE IN PROSTATE CANCER

O.A. Samoylenko1, E.O. Stakhovskyi2, Y.V. Vitruk2, V.O. Shlyakhovenko1

1R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

2National Cancer Institute, Ministry of Health of Ukraine, Kyiv, Ukraine

a-samoilenko@ukr.net

Introduction. Timely diagnosis of prostate cancer in a number of cases presents considerable difficulties. The methods proposed to date, including cytology, ultrasound, determination of the level of prostatic-specific antigen, do not give guarantee of a well-established diagnosis. An important additional indicator indicating the rapid proliferation of prostate cells is the determination of the level of ornithine decarboxylase (ODC) activity, the enzyme responsible for transforming the ornithine into putrescine.

Aim. To determine ODC activity in prostate tissue of patients with prostate cancer.

Materials and Methods. A highly sensitive technique based on the formation of a compound of putrescine and a picrylsulfonic acid was used allowing registering quickly the reaction product using spectrophotometer.

Results and Discussion. Determining ODC activity in prostate tissue of 46 patients with prostate cancer (I–IV stages) aged 50–78, it was found that the highest rates of enzymatic activity was at the initial stages as well as in the terminal period of the disease.

Conclusion. The data obtained can be used for specifying the diagnosis and monitoring the disease.

QUINAZOLINE DERIVATIVES AND TUMOR GROWTH

N.I. Sharykina, A.M. Demchenko, A.G. Radivoievych, M.A. Munko, T.A. Bukhtiarova

State Institution “Institute of Pharmacology and Toxicology, NAMS of Ukraine”, Kyiv, Ukraine

sharykina-39@ukr.net

Introduction. The targeting substances capable of inhibiting activity of the expressed components of the intracellular signaling pathways are in the focus of research since the beginning of XXI century. Quinazoline derivatives, gefitinib and erlotinib, are among the first such inhibitors representing the selective inhibitors of epidermal growth factor receptor (EGFR). Both drugs have been approved for the treatment of non-small cell lung cancer (NSCLC).

The team headed by Prof. A.M. Demchenko at the SI “Institute of Pharmacology and Toxicology, NAMS of Ukraine” has synthesized various quinazoline derivatives that may possess activities similar to gefitinib and erlotinib.

Aim. To compare new quinazoline derivatives with erlotinib in silico, in vitro and in vivo for selecting the compounds that may be promising for further preclinical study.

Materials and Methods. Docking analysis with the use of model tyrosine kinases, cytostatic activity in A549 cells, antitumor activity in the model of sub-renal capsule heterologous transplantation of clinical NSCLC samples in CBA mice, immunofluorescent assay.

Results and Discussion. Among 17 new quinazoline derivatives analyzed by docking analysis, two compounds were characterized by lower energy for binding with model tyrosine kinases from databank as compared with erlotinib.

DeltaG_2YS2

DeltaG_2ITY

2-(2-allyl-4-oxo-3,4-dihydroquinazoline-2-yl-sulfanyl)-N-(2,6-dihydrophenyl)-acetamide — Compound 1

–30.41 kcal/mol

–34.74 kcal/mol

Ethyl-2-(quinazoline-4-yl-amino)-4,5,6,7-tetrahydro-1-benzothiofen-3-carboxylate hydrochloride — compound 2

–33.86 kcal/mol

Erlotinib

–27.28 kcal/mol

–24.65 kcal/mol

Cytostatic activity of these two compounds in A549 cells (MTT test) exceeded that of erlotinib (lg IC50 values –5.1 for compound 1, –5.2 for compound 2, –4.4 for erlotinib).

In subcapsular assay, the growth inhibition for three NSCLC samples by compound 1 was 23.0%, 25.0% and 34.8%.

Immunoenzyme assay demonstrated inhibition of phosphotyrosine fluorescence (in assay with monoclonal against phosphotyrosine) by compound 1 and erlotinib.

Conclusion. Compound 1 and compound 2 possess high cytostatic activity in NSCLC cells (A549) in vitro. Compound 1 is active in inhibiting tumor growth of heterogenous subcapsular grafts in vivo. Both compounds share the similar mechanism of action with erlotinib (EGFR inhibition). These compounds are promising candidates for further studies as potential antitumor drugs.

CD150 IS A POSITIVE REGULATOR OF CD20 EXPRESSION IN CHRONIC LYMPHOCYTIC LEUKEMIA B CELLS

V. Shcherbina, I. Gordiienko, T. Ivanivskaya, L. Shlapatska

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

L_knolodniuk@ukr.net

Introduction. CD20 is B-cell surface antigen, which is expressed starting from pre-B stage of B-cell development and remains up to formation of plasma cells. Chronic lymphocytic leukemia (CLL) is characterized by decreased CD20 expression on malignant B cells as compared to normal B cells and cells of non-Hodgkin’s lymphomas. Low CD20 expression level is associated with worse effectivity of anti-CD20 mAb-based therapy in CLL patients. It is known that transcription factor PU.1 is a positive regulator of CD20 expression level but PU.1 expression is also downregulated in CLL. We have previously shown that CD150 and CD180 cell surface receptors are linked to regulation of transcription programs in normal and malignant B cells.

The aim of our study was to find out whether CD150 and CD180 receptors are involved in regulation of PU.1 — CD20 signaling axis.

Materials and Methods. The study was performed on peripheral blood mononuclear cells isolated from previously untreated CLL patients. Flow cytometry was used for immunophenotyping CLL B cells. The mRNA expression level was measured by real-time PCR. Western blot analysis was used for detection of protein expression.

Results and Discussion. Based on flow cytometry results, median of CD20 expression was significantly elevated in CD150+ CLL cases as compared to CD150 ones. Besides, there is a positive correlation between CD20 and CD150 cell surface expression on CLL B cells (r = 0.45; p < 0.05). PU.1 protein was detected predominantly in CD150+ CLL cases despite the fact that PU.1 mRNA expression level was almost the same in CD150+ and CD150 CLL B cells. To find out whether CD150 and CD180 may regulate PU.1 — CD20 signaling axis, in vitro ligation of mentioned receptors alone and in combination on CLL B cells were performed. We found that ligation of CD150 and CD180 alone or in combination on CLL B cells resulted in increasing PU.1 mRNA and protein expression level. Cell surface CD20 expression was upregulated after CD150 ligation up to 1.7 times compared to CLL B cells cultivated in medium alone. CD180 ligation alone or in combination with CD150 also led to elevation of CD20 expression in CLL B cells, but effect was less pronounced as compared to CD150 ligation.

Conclusions. CD150 and CD180 are positive regulators of PU.1 — CD20 signaling axis in CLL B cells. However, CD150 shows stronger effect in PU.1 and CD20 upregulation in CLL B cells than CD180. These results suggest that CD150 ligation may be a potential approach to increasing sensitivity of CLL B cells to anti-CD20 mAb-based therapy via upregulation of the CD20 cell surface expression on malignant B cells.

DUAL ROLE OF RIBONUCLEASES IN THE RELATIONSHIP OF TUMOR AND HOST

V.O. Shlyakhovenko, O.A. Samoylenko

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

doctorvlad38@gmail.com

Introduction. Ribonucleases (RNases), enzymes that destroy RNA, play an important role in protein synthesis, epigenetic regulation, cell proliferation and apoptosis. RNases are important antimicrobial, antiviral and immune defense factors.

Aim. The analysis of current data on the ambiguous role of RNases in the relationship between the tumor and the host.

Results and Discussion. Despite similar biochemical properties, RNases exhibit unequal, sometimes opposite biological effects. While most RNases inhibit cell proliferation, induce apoptosis and inhibit the growth of tumors, other RNases stimulate vascular growth, proliferation and tumor growth. RNase inhibitors have the opposite effect.

Conclusion. The correct use of these features of RNases can provide additional opportunities in the development of a strategy of targeted effects on tumor growth.

ECTOPIC PLACENTAL-LIKE ALKALINE PHOSPHATASE REPROGRAMMING BY VITAMIN E EXPOSURE IN LEUKEMIC K562 CELLS

L.P. Shvachko1, M.P. Zavelevich2, D.F. Gluzman2, G.D. Telegeev1

1Institute of Molecular Biology and Genetics, NAS of Ukraine, Kyiv, Ukraine

2R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

l.shvachko@ukr.net

Introduction. Placental-like alkaline phosphatase (PLAP) enzymes are expressed by many tumors and can be detected in sera of patients with various cancers. Their ectopic expression has been considered to be potentially useful as tumor marker. Indeed, elevated levels of PLAP were found in 4% of seminomas and in 75% of recurrent metastatic tumors. However, the biological background of the role of this aberrant alkaline phosphatase in cancer progression is still unclear. We have focused on the study of the biological role of PLAP in leukemogenesis on the model of chronic myeloid leukemia (CML) K562 cells.

Aim. The aim of the study was to attempt to use vitamin E for leukemic stem cell (LSC) reprogramming by inducing C/EBP alpha (CCAAT/enhancer-binding protein α) and G-CSFR (granulocyte colony stimulating factor receptor) analyzing aberrant PLAP as biomarker of LSC phenotype.

Materials and Methods. RNA extracted from K562 cells cultured with vitamin E was converted to cDNA, which was diluted to 2 ng/μL for quantitative SYBR Green qRT-PCR analysis using primers to tissue nonspecific alkaline phosphatase (TNAP) and C/EBP alpha respectively. Samples were cycled using the standard SYBR Green protocol on Q5 Bio-Rad StepOne qPCR instrument and analyzed using the comparative cycle threshold (CT) method to obtain relative mRNA expression. Amplicon (410 bp) was eluted from agarose gel (2.5%) and DNA-sequenced.

Results and Discussion. The progression of CML to blast crisis is correlated with both down-modulation of TNAP and C/EBP alpha as master regulator of granulocytic differentiation in myelopoesis. We have observed the ectopic expression of mRNA PLAP in K562 cells by real-time RT-PCR. We founded by sequencing that PLAP gene corresponds to embryonic type of PLAP (EPLAP) and has no gene homology with tissue placental alkaline phosphatase that was absent in K562. Vitamin E decreases the mRNA PLAP expression level and increases the mRNA TNAP expression. Moreover, along with down-regulation of aberrant PLAP and up-regulation of TNAP, vitamin E in a dose of 100 µM increases mRNA expression of transcription factor C/EBP alpha and G-CSFR. It was reported that osteoblast-expressed TNAP is a biomarker of hematopoietic stem cells (HSCs) and directly associated with HSC hematopoiesis in bone marrow (BM). We have proposed that loss of NAP in BM HSC niche may contribute into CML pathogenesis suggesting the impairment of BM mesenchymal stem cell — derived osteoblast differentiation. The aberrant PLAP in K562 cells seems to differ from tissue TNAP and tissue placental alkaline phosphatase.

Conclusion. EPLAP may be considered as a putative target in differentiation therapies in myeloid leukemias. Our findings suggest the potential role of vitamin E in adjuvant therapy of leukemia as the inducer of differentiation potential of K562 leukemic cells through decreasing ectopic EPLAP along with induction of granulopoiesis factors C/EBP alpha and G-CSFR. We have declared that embryonic PLAP is pluripotent LSC-associated biomarker in contrast of TNAP as multipotent HSC-associated biomarker. Vitamin E may be a putative modulator of LSCs reprogramming in biotherapies of CML.

INFLUENCE OF REV3L, REV1 AND POLI GENETIC VARIANTS ON THE RISK AND CLINICAL COURSE OF BLADDER CANCER

M. Smal1, A. Rolevich2, T. Nabebina2, S. Krasny2, R. Goncharova1

1Institute of Genetics and Cytology, National Academy of Sciences of Belarus, Belarus

2N.N. Alexandrov National Cancer Centre, Belarus

marharyta.smal@gmail.com

Introduction. During DNA replication, classical DNA polymerases get stalled at sites of DNA damage caused by exogenous and endogenous agents. To complete DNA replication and maintain genome integrity, several damage bypass mechanisms have evolved. A major of them is translesion synthesis (TLS) performed by a set of low-fidelity TLS DNA polymerases. Both under- and overexpression of these polymerases can lead to an increased mutation rate and, as a result, to carcinogenesis. Despite the important role of TLS DNA polymerases in protecting human cells against damage, their contribution to bladder cancer risk and pathogenesis remains poorly studied. We hypothesized that single nucleotide polymorphisms (SNPs) in the genes encoding TLS polymerases could affect enzyme activities by altering gene expression and protein structure. This, in its turn, might impact cancer risk and clinical outcome.

The aim of our research was to analyze the association between a panel of eleven polymorphisms from the REV3L, REV1 and POLI genes, involved in TLS, and bladder cancer risk as well as disease clinical course.

Materials and Methods. 219 bladder cancer patients and 219 healthy controls, matched for age and sex, were included in the study. SNP genotyping was performed using Real-Time PCR and SNaPshot assay.

Results and Discussion. Individual SNP analysis showed that among all the polymorphisms studied only REV3L rs240969 was significantly associated with bladder cancer risk: urothelial carcinomas were diagnosed less frequently in carriers of the CT+TT genotypes (OR 0.62; 95% CI 0.40–0.96; p = 0.03) or the minor T allele (OR 0.67; 95% CI 0.45–0.98; p = 0.04). Evaluation of the pairwise SNP-SNP interactions also demonstrated the protective effect of the REV3L CT+TT (rs240969) genotypes in the combination with REV1 TC (rs3087399) (p = 0.0017), REV1 CA (rs6761390) (p = 0.007) and POLI GG+GA (rs3017302) (p = 0.014) genotypes on bladder cancer susceptibility. Besides, haplotype analysis revealed that the subjects with the REV3L ‘A-A-T-C’ (rs465646-rs462779-rs240969-rs3204953) haplotype had decreased risk of tumor development (OR 0.58; 95% CI 0.38–0.89; p = 0.013).

When examining the genotype distribution by urothelial carcinoma clinical features, we observed that the patients with REV3L (rs11153292) CT+TT (p = 0.02) or homozygous POLI (rs8305) GG (p = 0.011) genotypes were more likely to suffer from muscle-invasive disease. Moreover, incidence of high-grade tumors tended to be or was significantly higher in homozygous carriers of the minor alleles T of rs3087403 (p = 0.06), G of rs8305 (p = 0.08) and A of rs3017302 (p = 0.01). When analyzed together, the presence of at least one such homozygous genotype was significantly associated with a higher tumor grade (p = 0.0005) and larger tumor size (p = 0.04). Cox regression analysis revealed that the heterozygote variant of the REV3L SNP (rs465646) increased patients’ odds of surviving with HR 0.35 (95%CI 0.14–0.87; p = 0.025).

Conclusions. Our results suggest that SNPs within the genes encoding TLS DNA polymerases may not only affect bladder cancer susceptibility, but also influence tumor phenotype and patient chances of surviving.

PERSONALIZATION OF CANCER TREATMENT WITH CIRCULATING TUMOR CELLS TEST

S. Souchelnytskyi

College of Medicine, Qatar University, Doha, Qatar

Oranta Cancer Diagnostics AB, Uppsala, Sweden

serhiy@qu.edu.qa

Introduction. Detection of circulating tumor cells (CTCs) is a prognostic marker of aggressive development of solid tumors.

Aim. To present and discuss recent efforts in use of CTCs tests for diagnostics and selection of treatment.

Materials and Methods. CTCs were recovered from peripheral blood and cultured in vitro to assess their carcinogenic transformation potential, proliferation, spheroid formation capacities and expression of E-cadherin, vimentin and, for glioblastoma patients, Glial fibrillary acidic protein.

Results and Discussion. CTCs were detected in the blood of cancer patients by selecting the cells with characteristics of transformed cells, i.e. by CTCs growth, spheroid formation and expression of markers. The developed test allows to discriminate between aggressive and non-aggressive tumors. Clinical value of such discrimination is in selection of appropriate treatment, notably avoiding over- and under-treatment. CTCs tests have been performed for patients with breast, pancreas, liver, bladder, lymphoma, colorectal and prostate cancers. In addition to diagnostics, recovered CTCs allowed tests of drug sensitivity. Anticancer treatments were evaluated. This gives clinicians a basis for informed and evidence-based individualized selection of drugs. As examples of the CTCs test application, I will present data of CTCs tests for glioblastoma and breast cancer patients.

Conclusions. This report confirms the value of recovery of living CTCs from the blood of cancer patients for monitoring and prediction of the disease development, and for selection of treatment.

STUDY OF THE ACTIVITY OF PI3K/Akt/mTOR SIGNALLING PATHWAY IN PATIENTS WITH TYPE 2 DIABETES AND PANCREATIC CANCER

T.S. Vatseba1, L.K. Sokolova2,V.M. Pushkarev2,M.D. Tronko2

1Ivano-Frankivsk National Medical University, Ivano-Frankivsk, Ukraine

2V.P. Komisarenko Institute of Endocrinology and Metabolism, NAMS of Ukraine, Kyiv, Ukraine

tamara.vatseba@gmail.com

Introduction. Recent studies have proved an increased risk of cancer of certain localizations, including pancreatic cancer in patients with type 2 diabetes mellitus (T2D). Pathogenetic factors of diabetes mellitus (DM), such as obesity, hyperinsulinemia, hyperglycemia and cytokine imbalance cause changes in the systems of regulation of the cell apoptosis and survival. The PI3K/Akt/mTOR signaling pathway is one of the regulatory systems that are involved by T2D through the influence of insulin and insulin-like growth factor-1 (IGF-1). Phosphorylation of protein kinases PRAS40 (proline-rich Akt substrate 40 kDa) and p70S6K1 (ribosomal S6 protein kinase), which are the components of the PI3K/Akt/mTOR signaling pathway, activates mTOR (a mammalian target of rapamycin). As peripheral blood mononuclear cells (PBMCs), lymphocytes and macrophages are involved in the pathogenesis of diabetes and cancer, it is worth studying the activity of the concerned protein kinases in these cells.

Aim. To investigate the activity of the PI3K/Akt/mTOR signaling pathway by determining the content of phosphorylated PRAS40 and p70S6K1 in patients with pancreatic cancer developed in the setting of T2D.

Materials and Methods. 38 persons were examined and divided into groups: I — healthy (control group) (n = 10), II — patients with T2D (n = 12), III — patients with pancreatic cancer without T2D (n = 10), IV — patients with a combination of pancreatic cancer and T2D (n = 6). Patients were grouped accordingly to age and BMI. Therapy for patients with DM in groups II and IV included various combinations of hypoglycemic drugs and insulin. Blood sampling in patients with pancreatic cancer was performed before the chemotherapy.

The content of PRAS40 [pT246] and p70S6K1 (Total/Phospho) was determined in PBMCs using the ELISA kit КНО0421 and ELISA kit 85-86053 (Invitrogen, USA). Immediately after collection, blood was centrifuged using Histopaque 1077 (Sigma, USA). The obtained white blood cells were washed and frozen at –80 °C before use. The cells were lysed in a buffer for extraction using a kit containing protease and phosphatase inhibitors. Studies were conducted in triplicates. The concentration of protein in lysate was determined using the kit “BCA protein assay kit” (Novagen, USA). Absorbance was measured with a microplate reader (“Bio-tek Instruments”, USA) at a wavelength of 450 nm. Insulin and IGF-1 levels were determined using the automatic analyzer Stat fax 303+ (Awareness Technology, USA) using diagnostic kits Іnsulin ELISA, EIA-2935 and IGF-1 600 ELISA, EIA-4140 (DRG, Germany). DM compensation was assessed by determining the level of HbA1c by ion-exchange chromatography, using the D-10 analyzer (BIO-RAD, USA). PRAS40, insulin, IGF-1 and HbA1c levels were determined in units, according to the study guide; the level of p70S6K1 was determined in conventional units, depending on the amount of protein in the blood cell lysates, according to the protocol of the study. Data were analyzed using Statistica 12.0 (StatSoft Inc., USA) program. Differences between the values in the control and experimental groups were determined using One-Way-ANOVA and Student’s t-test. Values of p < 0.05 were considered as significant.

Results and Discussion. In 54.5% of patients in group III and in 80.0% of patients in group IV pancreatic cancer was diagnosed at the stage IV. The average duration of T2D in patients of group IV before detection of pancreatic cancer was 2.80 ± 1.64 years. In patients from both groups with pancreatic cancer, obesity was not determined. BMI in patients of group III was 26.10 ± 2.58 kg/m2, and in group IV — 24.91 ± 2.62 kg/m2. The average level of HbA1c in patients in both groups with T2D was consistent with diabetes decompensation and was more than 7.5%. Significantly increased levels of insulin were detected only in patients with T2D of group II compared with control group (p < 0.05). IGF-1 level increased significantly in patients of groups II and III compared to the control group (p < 0.05). The levels of phospho-PRAS40 were detected to be increased in patients of group II and decreased in patients of group IV compared to the control group (p < 0.05). Significantly increased levels of phospho-p70S6K1 were revealed only in patients of group II compared with the control group (p < 0.05). The absence of reliable hyperinsulinemia and increased level of IGF-1 can be explained by the absence of obesity and insulin resistant condition or by the insulin insufficiency as the manifestation of parenchymal failure of pancreas by cancer. On the other hand, the absence of increased IGF-1 level in this group may be connected with insufficient protein synthesis in the liver of cancer patients at stage IV.

Conclusion. The obesity, hyperinsulinemia and elevated IGF-1 were not found in patients with pancreatic cancer developed in the setting of T2D in the last 3 years. Probably, they had secondary diabetes as a manifestation of pancreatic cancer. The absence of the increase in phospho-PRAS40 and phospho-p70S6K1 may be explained by the lack of trigger effects of hyperinsulinemia, IGF-1 and obesity, which play main roles in the activation of the PI3K/Akt/mTOR signaling pathway.

ELECTROKINETIC CHARACTERISTICS OF LYMPHOID CELLS IN HEALTHY DONORS AND PATIENTS WITH LEUKEMIA

Yu.V. Yanish, S.P. Zaletok, V.V. Bentrad

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

yanish_o@ukr.net

Aim. To study ζ-potential and total surface charge (TSC) of lymphocytes in healthy donors, patients with B-cells chronic lymphocytic leukemia (B-CLL), and acute myeloid leukemia (AML M1 and AML M5).

Materials and Methods. Methods of measuring electrokinetic parameters were presented earlier. Mononuclear cells of healthy donors and leukemia patients were isolated by centrifugation of peripheral blood in Ficoll-verografin gradient. B-lymphocytes were obtained from a common pool of mononuclear cells using sheep red blood cells. The leukocyte formula of the donors was determined using a PCE-210 hemoanalyzer. Blood samples were obtained from the Department of Oncohematology, IEPOR. Patients were informed about the research and agreed to use the clinical material. Statistical processing of the obtained results is carried out according to the generally accepted procedure.

Results and Discussion. In healthy donors, ζ-potential of the lymphocytes in the general pool at pH 7.4 was 10.3 ± 0.5 mV, TSC density = –7.4 ± 0.4 • 102 C/m2. B-lymphocytes of healthy donors had higher values: ζ = 13.0 ± 0.6 mV, TSC density = –9.3 ± 0.4 • 10–2 C/m2. Electrokinetic characteristics of lymphocytes in B-CLL patients showed a significant difference in values for men and women (ζ = 11.2 ± 0.4 mV, TSC density = –8.0 ± 0.6 • 10–2 C/m2 and ζ = 9.8 ± 0.5 mV, TSC density = –7.0 ± 0.3 • 10–2 C/m2, respectively). In general, the studied parameters were slightly lower than those for B-lymphocytes of healthy donors.

ζ-potential in monoblasts of AML M5 patients was 9.4 ± 0.5 in men and 8.1 ± 0.2 mV in women, and TSC density –6.9 ± 0.4 and –5.8 ± 0.1 • 10–2 C/m2, respectively. Their significance has not even reached the score in a general mononuclear pool of healthy donors. One explanation may be that the presence of polyamines on the surface of leukemic cells reduces the negative TSC. ζ-potential and negative TSC in AML M1 blast cells were half as much than in AML M5.

Conclusions. B-lymphocytes of healthy donors have significantly higher ζ-potential and negative TSC than lymphocytes of B-CLL patients and even blast cells of peripheral blood of AML patients. Cell electrophoresis can be used as an auxiliary prognostic method in a comprehensive individual assessment of leukemia patients.

SURFACE ELECTRIC CHARGE OF MACROPHAGES AND TUMOR CELLS AND THEIR METABOLIC ACTIVITY UNDER CONDITIONS OF ARTIFICIAL POLYAMINE DEFICIENCY IN MICE WITH L1210 LEUKEMIA

Yu.V. Yanish, S.P. Zaletok, O.A. Klenov

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

yanish_o@ukr.net

Introduction. Polyamines (PA) play an important role in the proliferation of tumor cells. Modulation of PA level may be advantageous for increasing the effectiveness of experimental antitumor therapy that may be relevant to the clinical practice.

Aim. The effects of PA inhibitors, α-difluoromethylornitine and methylglyoxal-bis-guanylhydrazone (DFMO and MGBG) on the spontaneous metabolic activity of peritoneal macrophages (PMPh), tumor cells (TC), ζ-potential and the density of the total surface electric charge (TSC) density of PMPh and TC were studied in mice with ascitic L1210 leukemia.

Materials and Methods. Metabolic activity of cells was determined using NBT test. Methods of measuring electrokinetic parameters were presented earlier. DFMO and MGBG were injected at 800 mg/kg and 40 μg/mouse for each injection respectively, according to the protocol of experiments.

Results and Discussion. PA synthesis inhibitors caused a potent stimulation of the metabolic activity of PMPh in CDF-1 mice with L1210 leukemia (DFMO by 181.5%, MGBG by 120.4%). At the same time, leukemic cells showed a decrease in their metabolic activity (by 54.0% and 45.0% respectively). DFMO and MGBG applied separately in animals with transplanted ascitic leukemia increased ζ-potential of TC to 14.11 ± 0.92 or 13.88 ± 1.48 mV, respectively as compared to 11.97 ± 0.72 mV in the control. Similarly, 17.9% and 16.0% increase in TSC density of TC for pH of 7.0 has taken place. Under the same conditions, both DFMO and MGBG reduced the electrokinetic parameters of PMPh in mice with tumors by 12.7 and 18.8% demonstrating the opposite direction of PA inhibitors effects.

Conclusions. The inverse correlation between ζ-potential, TSC density and metabolic activity of TC and PMPh of mice with transplanted L1210 leukemia was demonstrated. The search of factors that can cause inversion of the TSC sign of macrophages can be considered one of the perspective directions of further research. The combined effect of DFMO and MGBG returns the TSC density in TC and PMPh in animal with transplanted ascitic leukemia to the control values (8.58 ± 0.52 and 11.51 ± 0.68 • 10–2 C/m2 respectively), which does not rule out the availability of competitive mechanisms for the action of these PA inhibitors.

ANTITUMOR ACTIVITY OF ANTIVIRAL SUBSTANCE ISATIZON

L.A. Zaika1, O.I. Bolsunova1, A.I. Potopalskyi2, G.V. Didenko3, O.O. Kruts3

1Institute of Molecular Biology and Genetics, NAS of Ukraine, Kyiv, Ukraine

2Institute of Health Promotion and Rebirth of the People of Ukraine, Kyiv, Ukraine

3R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

Aim. To study antitumor and antimetastatic activity of antiviral substance isatizon in Lewis lung carcinoma.

Materials and Methods. Lewis lung carcinoma was transplanted to С57Вlаck mice intramuscularly (0.5 • 106 cells per mouse). Isatizon diluted in physiologic saline was administered per os starting from the 15th day after inoculation of tumor cells in a dose 50 µl at a 1:20 dilution, once a day for 10 days. The tumor growth dynamics and survival of the animals were followed. On the Day 27 after inoculation of tumor cells, the animals were sacrificed, the metastatic lesions in the lungs were assessed.

Results and Discussion. The dynamics of the growth of the primary tumor node in animals of isatizon group was similar to that in the group without treatment. Nevertheless, the final size of tumor differed. On Day 37, the average tumor size in isatizon group was 2.05 ± 0.46 mm3 as compared to 2.05 ± 0.46 mm3 in non-treated control. The survival of tumor-bearing animals on Day 37 was 33% in non-treated group and 72% in isatizon group. The mean volume of metastases (mm3 per animal) at the end of experiment was 141.87 ± 62.07 in non-treated control and 28.32 ± 12.43 in isatizon group. The mean number of metastases per animal was 75.5 ± 23.5 in non-treated animals and 29.4 ± 11.17 in isatizon group.

Conclusion. Antiviral substance isatizon possesses antitumor and antimetastatic activity in Lewis lung carcinoma.

DEVELOPMENT OF INDICATIONS FOR NEOADJUVANT CHEMICAL TREATMENT THERAPY IN COMPLEX TREATMENT OF NON-SMALL-CELL LUNG CANCER STAGE III

V.D. Zakharychev, K.A. Malyarchuk

P.L. Shupyk National Academy of Postgraduate Education, Kyiv, Ukraine

Materials and Methods. The analysis of the results of complex treatment with neoadjuvant chemotherapy (NCT)/neoadjuvant chemoradiation therapy (NCRT) was performed in 204 patients with non-small cell lung cancer (NSLC) stage III. For a comparative evaluation of treatment results, patients were divided into 3 groups. The main group (n = 34), which includes patients who received NCRT, the 1st control (n = 84) with N1 and the 2nd control (n = 86) with N2, treated with NCT. NCRT was prescribed according to indications: tumor germination in the chest wall — 3, tumor growth to the structures of the mediastinum — 3, the presence of positive l/y N2 — 28. All patients underwent 2–4 courses of chemotherapy according to the cisplatin/carboplatin + paclitaxel scheme. Radiation therapy was performed in the mode of daily sessions of 2 Gy (5 times a week) in a total dose of 29.5–30.5 Gy. The operation was performed 3 weeks after the end of the NCT. All operations were radical. The degree of morphological tumor response in all groups was analyzed and correlated with patient survival.

Results and Discussion. The life expectancy of patients in the main group ranged from 7 months to 11 years, the median survival rate was 29 months. In the 1st control group, life expectancy ranged from 8.5 to 120 months, CF — 25 months. In the 2nd control group, life expectancy is from 5 to 49 months. In the main group, a complete morphological tumor response was detected in 5 (11%) patients. In this group of patients, life expectancy ranged from 2 to 9 years with an average of 45 months. In addition, in the main group, 5 (11%) patients showed a high degree of morphological response > 12.5%. The life expectancy of these patients ranged from 4.6 to 10.1 years, the average life expectancy was 39 months. In both control groups, a complete morphological response was obtained in total in 3% of patients. With a full and almost complete morphological response, G2 and G3 degrees of tumor differentiation were encountered.

Conclusion. There was a tendency to an increase in survival in the group of patients who received NCRT compared with patients who received NCT. The number of cases of a high morphological degree is significantly more frequent after NCRT than after NCT, the average survival rate in these patients is significantly higher than in patients without a high degree of morphological response of the tumor. The frequency of postoperative complications and mortality in patients after NCRT did not increase, therefore, for patients with stage III NSLC, the use of NCRT does not increase the risks of treatment as compared.

The use of NCRT instead of NCT for patients with stage III NSLC is justified in the following cases:

1. Pain syndrome due to tumor growth into the chest wall.

2. The presence of positive l/y N2.

3. Certainly resectable tumor due to its growth to the structures of the mediastinum.

FEATURES OF POLYAMINE SPECTRUM IN PERIPHERAL BLOOD MONONUCLEAR FRACTION OF PATIENTS WITH DIFFERENT LYMPHO- AND MYELOPROLIFERATIVE DISEASES

S.P. Zaletok, O.A. Klenov, V.V. Bentrad, O.А. Orlovsky, Yu.V. Yanish, L.M. Sklyarenko

R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv, Ukraine

sophiazaletok@ukr.net

Introduction. Features of polyamine (PA) metabolism in different kinds of malignant cells are described in a large set of publications grounding application of the PA metabolism modulators as anticancer drugs. Some experience of such application is known, especially, in the field of leukemia treatment. At the same time, PA metabolism was studied in detail only in solid tumors. Only few publications deal with PA metabolism in leukemia.

Aim. To elucidate the main features of PA spectrum in blood mononuclear fraction of patients with chronic B-lymphoid leukemia (B-CLL), non-Hodgkin’s lymphomas (NHL) and acute forms of leukemia and their possible significance for diagnosis, prognosis and treatment of different lympho- and myeloproliferative diseases.

Materials and Methods. 82 patients with B-CLL, 65 — with acute myeloid leukemia (AML) M1-M5, 25 — with acute B-lymphoblastic leukemia (B-ALL), 30 — with different types of NHL and 23 — with other oncohematological diseases were included into the study. Diagnosis was verified by morphological, cytochemical and immunocytochemical methods in the Department of Oncohematology, IEPOR. Mononuclear fraction (MNF) of peripheral blood was isolated by common method (centrifugation in ficoll-urographin gradient). B-lymphocytes were isolated from MNF using sheep erythrocytes. PA content was measured by HPLC method.

Results and Discussion. In MNF of B-CLL patients, content of acetylated PA (AcPA) was lower than in donor lymphocytes, other PA parameters, including Spd/Spn molar ratio, were similar to those in donors cells. At the same time, MNF of B-CLL patients demonstrated higher Spn content and lower Spd/Spn ratio in comparison with different acute leukemia patients. In B-ALL with CD13 coexpression, contrary to common type of B-ALL, AcPA were absent and Spd/Spn ratio was enhanced up to 1.15 versus 0.46. The highest Put content and Spd/Spn ratio were found in patients with Т-lymphoblastic leukemia/lymphoma (Spd/Spn = 3.78). PA levels and Spd/Spn ratio were essentially different in patients with different types of NHL: in MNF of mantle B-cell lymphoma patients without leukemization, low Put and high Spn level and low Spd/Spn ratio (0.13) were found; if leukemization was observed, levels of Put, Spd and Spd/Spn ratio were much higher (by 8.6, 3.3 and 4.8 times).

Conclusions. New basic data on PA spectrum features in malignant blood cells of patients with different lympho- and myeloproliferative diseases were obtained. Such parameters as content of different PA fractions and Spd/Spn molar ratio in MNF may be used as supplementary markers for diagnosis and prognosis of the diseases.

No Comments » Add comments
Leave a comment

ERROR: si-captcha.php plugin says GD image support not detected in PHP!

Contact your web host and ask them why GD image support is not enabled for PHP.

ERROR: si-captcha.php plugin says imagepng function not detected in PHP!

Contact your web host and ask them why imagepng function is not enabled for PHP.